The Tyrosine Kinase Negative Regulator c-Cbl as a RING-Type, E2-Dependent Ubiquitin-Protein Ligase
10.1126/science.286.5438.309
Crossref journal-article
American Association for the Advancement of Science (AAAS)
Science (221)
Abstract

Ubiquitination of receptor protein-tyrosine kinases (RPTKs) terminates signaling by marking active receptors for degradation. c-Cbl, an adapter protein for RPTKs, positively regulates RPTK ubiquitination in a manner dependent on its variant SRC homology 2 (SH2) and RING finger domains. Ubiquitin-protein ligases (or E3s) are the components of ubiquitination pathways that recognize target substrates and promote their ligation to ubiquitin. The c-Cbl protein acted as an E3 that can recognize tyrosine-phosphorylated substrates, such as the activated platelet-derived growth factor receptor, through its SH2 domain and that recruits and allosterically activates an E2 ubiquitin-conjugating enzyme through its RING domain. These results reveal an SH2-containing protein that functions as a ubiquitin-protein ligase and thus provide a distinct mechanism for substrate targeting in the ubiquitin system.

Bibliography

Joazeiro, C. A. P., Wing, S. S., Huang, H., Leverson, J. D., Hunter, T., & Liu, Y.-C. (1999). The Tyrosine Kinase Negative Regulator c-Cbl as a RING-Type, E2-Dependent Ubiquitin-Protein Ligase. Science, 286(5438), 309–312.

Authors 6
  1. Claudio A. P. Joazeiro (first)
  2. Simon S. Wing (additional)
  3. Han-kuei Huang (additional)
  4. Joel D. Leverson (additional)
  5. Tony Hunter (additional)
  6. Yun-Cai Liu (additional)
References 48 Referenced 846
  1. Hicke L., FASEB J. 11, 1215 (1997); (10.1096/fasebj.11.14.9409540) / FASEB J. by Hicke L. (1997)
  2. Heldin C.-H., Östman A., Rönnstrand L., Biochim. Biophys. Acta 1378, F79 (1998) . / Biochim. Biophys. Acta by Heldin C.-H. (1998)
  3. 10.1146/annurev.biochem.67.1.425
  4. Haas A. L., Siepmann T. J., FASEB J. 11, 1257 (1997). (10.1096/fasebj.11.14.9409544) / FASEB J. by Haas A. L. (1997)
  5. 10.1101/gad.13.12.1614
  6. 10.1126/science.284.5414.662
  7. 10.1016/S0092-8674(00)80574-7
  8. Lee P. S., et al., EMBO J. 18, 3616 (1999). (10.1093/emboj/18.13.3616) / EMBO J. by Lee P. S. (1999)
  9. Miyake S., Lupher M. L., Druker B., Band H., Proc. Natl. Acad. Sci. U.S.A. 95, 7927 (1998); (10.1073/pnas.95.14.7927) / Proc. Natl. Acad. Sci. U.S.A. by Miyake S. (1998)
  10. Miyake S., Mullane-Robinson K. P., Lill N. L., Douillard P., Band H., J. Biol. Chem. 274, 16619 (1999). (10.1074/jbc.274.23.16619) / J. Biol. Chem. by Miyake S. (1999)
  11. 10.1101/gad.12.23.3663
  12. Waterman H., Levkowitz G., Alroy I., Yarden Y., J. Biol. Chem. 274, 22151 (1999). (10.1074/jbc.274.32.22151) / J. Biol. Chem. by Waterman H. (1999)
  13. 10.1126/science.7652556
  14. Tan P., et al., Mol. Cell 3, 527 (1999); (10.1016/S1097-2765(00)80481-5) / Mol. Cell by Tan P. (1999)
  15. ; T. Ohta J. J. Michel A. J. Schottelius Y. Xiong ibid. p. 535; T. Kamura et al. Science 284 657 (1999); W. Zachariae et al. ibid. 279 1216 (1998).
  16. DNA fragments encoding the RING finger were amplified by polymerase chain reaction (PCR) of c-Cbl WT and 70Z/3 cDNA with primers CAAGACCATATCAAAGTGACCCAG and CTATGCTCCTTGCCTCAACAG. PCR products were subcloned first into pCRII verified by sequencing and then subcloned into the Eco RI site of pGEX-4T2. Point mutations were generated with QuikChange (Stratagene) with pGEX-4T2-RING as template. pGEX-cbl 1-480 (encoding GST-SH2-RING) was a gift from L. Samelson. GST fusion proteins were produced in E. coli BL21 (DE3) by induction with 0.4 mM isopropyl-β- d -thiogalactopyranoside for 3 hours at 30°C. Cells were lysed in 50 mM tris-HCl (pH 8) 120 mM NaCl 1 mM dithiothreitol (DTT) and protease inhibitors. Proteins bound to glutathione-Sepharose beads were eluted with lysis buffer containing 20 mM glutathione and dialyzed against lysis buffer containing 50 mM NaCl and 10% glycerol.
  17. His-tagged E1 (a gift of F. Yamao) and Ubc4 [a gift of M. Nakao;
  18. Anan T., et al., Genes Cells 3, 1 (1998); (10.1046/j.1365-2443.1998.00227.x) / Genes Cells by Anan T. (1998)
  19. ] were produced as in (11) except that Talon beads (Clontech) and 100 mM imidazole were used for His-tagged protein binding and elution respectively. Iodination of Ub was as described [
  20. Oughtred R., Bedard N., Vrielink A., Wing S. S., J. Biol. Chem. 273, 18435 (1998); (10.1074/jbc.273.29.18435) / J. Biol. Chem. by Oughtred R. (1998)
  21. ]. Ubiquitination and Ubc4 activation assays: Reactions (10 to 15 μl) contained His-E1 (50 to 500 nM) His-Ubc4 (0.5 to 5 μM) GST fusion proteins (10 μg) ubiquitin (5 μM) and ATP (2 mM) in Ub buffer [50 mM tris-HCl (pH 7.5) 2.5 mM MgCl 2 and 0.5 mM DTT]. Incubation was at 23°C for 90 min unless otherwise indicated. Reactions were stopped with 2× SDS sample buffer containing 4% SDS and 5.8 M β-mercaptoethanol. Ub-protein ligation was dependent on the presence of both E1 and Ubc4 (21). Ubc4 was chosen for these experiments because it had been shown to support EGF-R ubiquitination in fractionated cell extracts [
  22. Mori S., et al., Eur. J. Biochem. 247, 1190 (1997); (10.1111/j.1432-1033.1997.01190.x) / Eur. J. Biochem. by Mori S. (1997)
  23. ]. Monoclonal antibodies used for protein immunoblots were anti–Tetra-His (Qiagen) and anti-GST (Santa Cruz Biotechnology). Prestained molecular weight markers were used to determine approximate protein sizes.
  24. The difference between the distribution of Ub adducts in Fig. 1 A and B is likely due to the fact that any given poly-ubiquitination product of GST-RING has only one site for anti-GST binding but multiple labeled Ub moieties.
  25. The species indicated in Figs. 1C 2C and 3C as Ub n -Ubc4 are resistant to cleavage by 2.9 M β-mercaptoethanol and boiling and therefore do not represent E2∼Ub thioesters. The inefficiency of the Ubc4 activation reaction is likely due either to a lower propensity of Ubc4 to auto-ubiquitinate [as compared with Cdc34;
  26. Banerjee A., Gregori L., Xu Y., Chau V., J. Biol. Chem. 268, 5668 (1993); (10.1016/S0021-9258(18)53371-8) / J. Biol. Chem. by Banerjee A. (1993)
  27. ] or to the competing reaction ubiquitination of GST-RING.
  28. Andoniou C. E., Thien C. B., Langdon W. Y., EMBO J. 13, 4515 (1994). (10.1002/j.1460-2075.1994.tb06773.x) / EMBO J. by Andoniou C. E. (1994)
  29. 10.1111/j.1749-6632.1993.tb32280.x
  30. Hampton R. Y., Gardner R. G., Rine J., Mol. Biol. Cell 7, 2029 (1996). (10.1091/mbc.7.12.2029) / Mol. Biol. Cell by Hampton R. Y. (1996)
  31. Parkinson J., Lees-Miller S. P., Everett R. D., J. Virol. 73, 650 (1998). (10.1128/JVI.73.1.650-657.1999) / J. Virol. by Parkinson J. (1998)
  32. Grossberger R., et al., J. Biol. Chem. 274, 14500 (1999). (10.1074/jbc.274.20.14500) / J. Biol. Chem. by Grossberger R. (1999)
  33. GST pulldown assay: GST fusion protein (5 μg) and His-Ubc4 (1 μg) were incubated for 2 hours at 4°C in 1 ml of binding buffer [20 mM tris-HCl (pH 7.5) 150 mM NaCl 5 mM EDTA 1% NP-40 bovine serum albumin (25 μg/ml)] and then with 30 μl of glutathione-Sepharose beads (Pharmacia) for 30 min. Precipitates were washed four times with binding buffer and subjected to 12% SDS–polyacrylamide gel electrophoresis (PAGE) and immunoblotting with anti-Ubc4 [
  34. Rajapurohitam V., et al., Dev. Biol. 212, 217 (1999)]. (10.1006/dbio.1999.9342) / Dev. Biol. by Rajapurohitam V. (1999)
  35. C. A. P. Joazeiro and T. Hunter unpublished data.
  36. PDGF-Rβ cDNA in the pcDNA3 expression vector was transfected into 293T human embryonic kidney cells. Cells were kept in 0.5% serum for 48 hours before lysis with 10 mM tris-HCl (pH 7.5) 1% Triton X-100 5 mM EDTA 50 mM NaCl and protease inhibitors. PDGF-Rβ was immunoprecipitated from cleared lysates with PR7212 monoclonal antibody (a gift of D. Bowen-Pope). Beads were washed three times with lysis buffer and twice with 20 mM Hepes (pH 7.4) 100 mM NaCl and aprotinin (20 μg/ml). An in vitro kinase reaction with [γ- 32 P]ATP was done to label the receptor and to provide phosphotyrosine binding sites for the c-Cbl SH2 domain: Beads were washed twice and resuspended with kinase reaction buffer [20 mM Hepes (pH 7.4) 10 mM MnCl 2 aprotinin (20 μg/ml) and 20 μM Na 3 VO 4 ] to which 20 μCi of [γ− 32 P]ATP was added for 45 min at room temperature. The reaction was chased with 1 mM ATP for 20 min. Beads were washed once with phosphate-buffered saline containing 0.5 mM EDTA and four times with Ub buffer and samples were taken for ubiquitination reactions (12).
  37. The tyrosyl residues in RPTKs that mediate direct interaction with the Cbl SH2 domain are unknown. The association of the Cbl SH2 and COOH-terminal domains with RPTKs in vivo has been discussed [
  38. Smit L., Borst J., Crit. Rev. Oncog. 8, 359 (1997)]. (10.1615/CritRevOncog.v8.i4.50) / Crit. Rev. Oncog. by Smit L. (1997)
  39. To test whether cullins interact with c-Cbl in vivo to regulate its activity hemagglutinin A (HA)–tagged c-Cbl or Roc1 and Myc-tagged cullins were overexpressed in 293T cells. Whereas HA-tagged Roc1 efficiently coimmunoprecipitated with cullins 1 2 3 4A and 5 (3 4 10) (gifts of Z.-Q. Pan J. Michel and Y. Xiong) c-Cbl 70Z/3 Cbl and Cbl 1-480 (L. Samelson) failed to do so. In addition neither EGF stimulation nor v-Src coexpression promoted c-Cbl-cullin association (21).
  40. F. Ou and A. Varshavsky personal communication.
  41. Miyake S., et al., Crit. Rev. Oncog. 8, 189 (1997); (10.1615/CritRevOncog.v8.i2-3.30) / Crit. Rev. Oncog. by Miyake S. (1997)
  42. ; C. B. Thien and W. Y. Langdon Immunol. Cell Biol. 76 473 (1998); (10.1046/j.1440-1711.1998.00768.x)
  43. Liu Y.-C., Altmann A., Cell Signal. 10, 377 (1998). (10.1016/S0898-6568(97)00179-4) / Cell Signal. by Liu Y.-C. (1998)
  44. The intensity of these bands does not correlate with the Ub ligase activity of the protein preparation. In addition mixing of ubiquitination-defective c-Cbl RING mutants with the WT protein did not reduce the WT Ub ligase activity (21).
  45. Ponceau S staining and antibody cross-reaction with GST revealed similar relative amounts of GST fusion proteins.
  46. Claesson-Welsh L., et al., Mol. Cell. Biol. 8, 3476 (1988). / Mol. Cell. Biol. by Claesson-Welsh L. (1988)
  47. The efficiency of the reactions in Fig. 4A was determined as follows: Total counts in each lane (Ub n -Rβ + Rβ) were normalized to those in lane 1. Counts in the Ub n -Rβ or Rβ regions were then divided by the respective normalization factor. Counts in the Ub n -Rβ portion of each lane were further corrected by subtracting from the background in lane 1. The values in Fig. 4B were calculated as (Ub n -Rβ)/(Rβ + Ub n -Rβ). This measure is an underestimate because oligoubiquitinated precursor Rβ (160 kD) cannot be resolved from unmodified mature Rβ (190 kD) and oligoubiquitinated and unmodified mature Rβ bands are not resolved in 7.5% acrylamide gels.
  48. We thank M. Nakao L. Samelson F. Yamao and A. Kumar for reagents; D. Koepp for advice; A. Altman W. Langdon G. A. Kassavetis J. Noel M. Verdecia and the Hunter laboratory for discussions; E. P. Geiduschek for comments on the manuscript; C. Elly J. Meisenhelder S. Simon and A. Young for help and F. Orzalesi for encouragement. This work was supported by Fellowship 2-41-98 from the American Cancer Society California Division (C.A.P.J.) by Medical Research Council of Canada grant MT12121 (S.S.W.) by Fellowship DRG1531 from the Damon Runyon–Walter Winchell Foundation (H.-k.H.) by American Cancer Society grant PF9922801CCG and NIH grant T32CA09523 (J.D.L.) by grant R01 DK56558 from NIH (Y.-C.L.) and by U.S. Public Health Service grants CA39780 and CA82683 from the National Cancer Institute (T.H.). S.S.W. is a recipient of a Clinician-Scientist Award from the Medical Research Council of Canada; T.H. is a Frank and Else Schilling American Cancer Society Professor.
Dates
Type When
Created 23 years ago (July 27, 2002, 5:37 a.m.)
Deposited 1 year, 7 months ago (Jan. 13, 2024, 5:33 a.m.)
Indexed 2 weeks, 4 days ago (Aug. 5, 2025, 8:26 a.m.)
Issued 25 years, 10 months ago (Oct. 8, 1999)
Published 25 years, 10 months ago (Oct. 8, 1999)
Published Print 25 years, 10 months ago (Oct. 8, 1999)
Funders 0

None

@article{Joazeiro_1999, title={The Tyrosine Kinase Negative Regulator c-Cbl as a RING-Type, E2-Dependent Ubiquitin-Protein Ligase}, volume={286}, ISSN={1095-9203}, url={http://dx.doi.org/10.1126/science.286.5438.309}, DOI={10.1126/science.286.5438.309}, number={5438}, journal={Science}, publisher={American Association for the Advancement of Science (AAAS)}, author={Joazeiro, Claudio A. P. and Wing, Simon S. and Huang, Han-kuei and Leverson, Joel D. and Hunter, Tony and Liu, Yun-Cai}, year={1999}, month=oct, pages={309–312} }