Exon Shuffling by L1 Retrotransposition
10.1126/science.283.5407.1530
Crossref journal-article
American Association for the Advancement of Science (AAAS)
Science (221)
Abstract

Long interspersed nuclear elements (LINE-1s or L1s) are the most abundant retrotransposons in the human genome, and they serve as major sources of reverse transcriptase activity. Engineered L1s retrotranspose at high frequency in cultured human cells. Here it is shown that L1s insert into transcribed genes and retrotranspose sequences derived from their 3′ flanks to new genomic locations. Thus, retrotransposition-competent L1s provide a vehicle to mobilize non-L1 sequences, such as exons or promoters, into existing genes and may represent a general mechanism for the evolution of new genes.

Bibliography

Moran, J. V., DeBerardinis, R. J., & Kazazian, H. H. (1999). Exon Shuffling by L1 Retrotransposition. Science, 283(5407), 1530–1534.

Authors 3 University of Pennsylvania
  1. John V. Moran (first) University of Pennsylvania
  2. Ralph J. DeBerardinis (additional) University of Pennsylvania
  3. Haig H. Kazazian (additional) University of Pennsylvania
References 41 Referenced 484
  1. 10.1016/S0959-437X(96)80030-X
  2. Sassaman D. M., et al., Nature Genet. 16, 37 (1997). (10.1038/ng0597-37) / Nature Genet. by Sassaman D. M. (1997)
  3. Dombroski B. A., Mathias S. L., Nanthakumar E., Scott A. F., Kazazian H. H., Science 254, 1805 (1991). (10.1126/science.1662412) / Science by Dombroski B. A. (1991)
  4. Kazazian H. H., Moran J. V., Nature Genet. 19, 19 (1998). (10.1038/ng0598-19) / Nature Genet. by Kazazian H. H. (1998)
  5. Hohjoh H., Singer M. F., EMBO J. 16, 6034 (1997). (10.1093/emboj/16.19.6034) / EMBO J. by Hohjoh H. (1997)
  6. Feng Q., Moran J. V., Kazazian H. H., Boeke J. D., Cell 87, 905 (1996). (10.1016/S0092-8674(00)81997-2) / Cell by Feng Q. (1996)
  7. Mathias S. L., Scott A. F., Kazazian H. H., Boeke J. D., Gabriel A., Science 254, 1808 (1991). (10.1126/science.1722352) / Science by Mathias S. L. (1991)
  8. Fanning T., Singer M., Nucleic Acids Res. 15, 2251 (1987). (10.1093/nar/15.5.2251) / Nucleic Acids Res. by Fanning T. (1987)
  9. Boeke J. D., Nature Genet. 16, 6 (1997). (10.1038/ng0597-6) / Nature Genet. by Boeke J. D. (1997)
  10. Moran J. V., et al., Cell 87, 917 (1996). (10.1016/S0092-8674(00)81998-4) / Cell by Moran J. V. (1996)
  11. The mutant initiation codon and artificial splice acceptor sequences were introduced into p mneoI by polymerase chain reaction (PCR). The oligonucleotide primers SJ1 (5′-AAAGAATTCTACTAACTCTCTTCTCTCCTGCAGATAGGATCGGCCATTGAAC) SJ1 + 1 (5′-AAAGAATTCTACTAACTCTCTTCTCTCCTGCAGCATAGGATCGGCCATTGAAC) or SJ1 + 2 (5′-AAAGAATTCTACTAACTCTCTTCTCTCCTGCAGCCATAGGATCGGCCATTGAAC) were used in conjunction with 1720NEOS (5′-TGCGCTGACAGCCGGAACACG) to generate a 166-bp product. Reactions (one cycle: 94°C for 10 min; 30 cycles: 94°C for 1 min 50°C for 30 s 72°C for 30 s; one cycle: 72°C for 10 min) were performed as described (10). PCR products were digested with Eag I and Eco RI and the 0.06-kb fragments were used to replace the SV40 promoter in p mneoI. The mneoIRF1 to RF3 cassettes were subcloned into an engineered Sma I site in the 3′ UTR of L1.2 (10) and 7.9-kb Not I–Bam HI fragments containing the engineered L1s were subcloned into pCEP4 (InVitrogen) to create pJM101 RF1 to RF3. We replaced the L1.2 ORFs with a 5.9-kb Not I–Bst Z17I from JM101/L1.3 to create pJM101/L1.3 RF1 to RF3.
  12. J. V. Moran and H. H. Kazazian data not shown.
  13. Polyadenylated RNAs from pooled pJM101/L1.3-derived G418 R colonies were isolated with the Fast Track Kit (InVitrogen). cDNAs were synthesized from 5 μg of poly(A) RNA with a cDNA synthesis Kit (Stratagene). Products greater than 500 bp were isolated from a cDNA size fractionation column (Gibco-BRL) ligated into Uni-ZAP XR vector (Stratagene) and packaged with Gigapack III packaging extracts (Stratagene). The cDNA library was plated at a density of 10 000 to 30 000 plaques per plate and ∼500 000 clones were screened with a 0.46-kb neo probe. Secondary and tertiary screens were used to purify positive clones. Neo -containing inserts were liberated from the positive plaques with the ExAssist/SOLR in vivo excision protocol (Stratagene) and were sequenced with an Applied Biosystems DNA sequencer (ABI 377).
  14. Albertsen H. M., et al., Genomics 33, 207 (1996); (10.1006/geno.1996.0185) / Genomics by Albertsen H. M. (1996)
  15. . The sequences upstream of neo in the cDNA clones pJET1 to pJET7 were used to search available databases in the Baylor College of Medicine search launcher (kiwi.imgen.bcm.tmc.edu:8088/search-launcher/launcher.html). We determined that L1.3 inserted into intron 7 of the DOC2 gene (accession number ). The neo cDNA sequence was fused to spliced exons 1 to 7 of the DOC2 gene. Notably the exon 7–intron 7 junction in figure 1 of the cited paper is misplaced by one codon. The last triplet of the DOC2 exon 7 sequence is TCG. The fusion sequence is shown in Fig. 1C.
  16. Patton J. G., Porro E. B., Galceran J., Tempst P., Nidal-Ginard B., Genes Dev. 7, 393 (1993); (10.1101/gad.7.3.393) / Genes Dev. by Patton J. G. (1993)
  17. . The cDNA sequence upstream of the neo gene in pJET2 was derived from the PSF gene (accession number ). The PSF gene undergoes alternative splicing to generate two different mRNAs. The mutated ATA of mneoIRF1 was spliced to the fused upstream PSF exons precisely at the position in the cDNA that is known to undergo alternative splicing. Thus we deduce that L1.3 inserted into the intron either immediately upstream or immediately downstream of the alternatively spliced exon.
  18. The cDNA sequence upstream of neo in pJET3 was identical to that of human translation initiation factor eiF3 (accession number ). The cDNA sequence upstream of neo in pJET4 was identical to a human EST (accession number ). The cDNA sequence upstream of neo in pJET5 was similar ( P value = 4.0 e −32 ) to a human EST (accession number ).
  19. The cDNA sequences in pJET1 pJET3 pJET4 pJET5 and pJET6 were PCR amplified with Pfu polymerase (Stratagene) in 50-μl volumes. The same 3′ primer (3′ NEO Bam HI) used in each reaction was engineered to contain a unique Bam HI restriction site (5′-AAAGGATCCGATCCCCTCAGAAGAACTCG). The 5′ primer contained a unique Not I restriction site and spanned the putative initiation codon (ATG) present in the respective cDNAs with one of the following primers: pJET1p (5′-AAAGCGGCCGCCTTGCCATGTCTAACGAAGTAG) pJET3p (5′-AAAGCGGCCGCAAGATGGCGTCCCGCAAGGAAGGTACCGGC) pJET4p (5′-AAAGCGGCCGCCCTCGCCAGCAGGATGAAGTT) pJET5p (5′-AAAGCGGCCGCGGACGCAGGGAGGATGGGG) or pJET6p (5′-AAAGCGGCCGCGATGGAGAGCCTACATGAATGC). PCR reactions (one cycle: 94°C for 10 min; 30 cycles: 94°C for 1 min 56°C for 30 s 72°C for 4 min; one cycle: 72°C for 10 min) contained 10 U of Pfu polymerase 0.2 mM deoxynucleotide triphosphates and 200 ng of each DNA primer in buffer supplied by the vendor. The reactions were carried out at an annealing temperature 5°C below the T m (temperature at which 50% of double-stranded DNA or DNA/RNA hybrids is denatured) of the primers. The band-purified products were digested with Not I and Bam HI and then were subcloned into Bam HI–Not I–digested pCEP4 (InVitrogen). Transfections were carried out as described previously (10) .
  20. Complementary DNAs of pJET8 to pJET12 were derived from pJM101/L1.3 RF1 mRNA. In every case the L1 mRNA was polyadenylated at the predicted position of the SV40 poly (A) + site (10). This result confirms our previous findings (10) and shows that the L1 poly (A) + signal is bypassed readily if the SV40 poly (A) + is also present in the L1 expression construct. cDNA from pJET13 was truncated within the neo sequence and was uninformative in this analysis.
  21. M. Yandell and I. Korf personal communication.
  22. Korenberg J. R., Rykowski M. C., Cell 53, 391 (1988). (10.1016/0092-8674(88)90159-6) / Cell by Korenberg J. R. (1988)
  23. The mneoI indicator cassette was subcloned into a unique Cla I site downstream of the native L1.2 poly (A) + to create pJCC130. An 8.2-kb Not I–Bsp 120I fragment containing the tagged L1 was subcloned into the Not I site of pCEP4 to create pJM130. The L1.3 derivative was constructed as above. Constructs lacking pCMV were constructed by subcloning the engineered L1s into pCEP4ΔCMV.
  24. pJM130/L1.3 RF1 to RF3 and their ΔCMV derivatives were constructed as above by subcloning the mneoIRF1 mneoIRF2 and mneoIRF3 cassettes 3′ of L1 poly (A) + .
  25. The LRE1 3′ end and flanking sequence were PCR amplified with primers 3′ UTRSma (5′-TAACCCGGGCAATGTGCACATGTACCC) and 3′ L1.2 (5′-AAAGGATCCTTAATTAAGAACCGGAACAAGACAGAATG). PCR reactions (one cycle: 94°C for 10 min; 30 cycles: 94°C for 1 min 56°C for 30 s 72°C for 1 min 30 s; one cycle: 72°C 10 min) were performed as described (10). The 0.1-kb product was digested with Sma I and Bam HI and subcloned into pJCC5 creating pJCC48 (10). The mneoI indicator cassette was subcloned into either a Sma I site in the L1 3′ UTR or an engineered Pac I site 3′ of L1 poly (A) + of pJCC48 to create pJCC140 and pJCC141. 7.9-kb fragments containing the engineered L1s were subcloned into CEP4 to create pJM140 and pJM141. The L1.3 and ΔCMV derivatives were constructed as above. The ΔCMVΔSV40 poly (A) + derivatives were constructed by subcloning the engineered elements into pCEP4ΔCMVΔSV40 poly (A) + .
  26. Conway L., Wickens M., Proc. Natl. Acad. Sci. U.S.A. 82, 3949 (1985). (10.1073/pnas.82.12.3949) / Proc. Natl. Acad. Sci. U.S.A. by Conway L. (1985)
  27. Miki Y., et al., Cancer Res. 52, 643 (1992). / Cancer Res. by Miki Y. (1992)
  28. Holmes S. E., Dombrowski B. A., Krebs C. M., Boehm C. D., Kazazian H. H., Nature Genet. 7, 143 (1994). (10.1038/ng0694-143) / Nature Genet. by Holmes S. E. (1994)
  29. McNaughton J. C., et al., Genomics 40, 294 (1997). (10.1006/geno.1996.4543) / Genomics by McNaughton J. C. (1997)
  30. Rozmahel R., et al., ibid. 45, 554 (1997). / ibid. by Rozmahel R. (1997)
  31. Martin S. L., Gene 153, 261 (1995). (10.1016/0378-1119(94)00785-Q) / Gene by Martin S. L. (1995)
  32. 10.1073/pnas.94.15.7698
  33. Lupski J. R., Mol. Med. 4, 3 (1998). (10.1007/BF03401724) / Mol. Med. by Lupski J. R. (1998)
  34. Leder P., Konkel D., Leder A., Nishioka Y., Natl. Cancer Inst. Monogr. 60, 49 (1982). / Natl. Cancer Inst. Monogr. by Leder P. (1982)
  35. Barr F. G., Nature Genet. 19, 121 (1998). (10.1038/475) / Nature Genet. by Barr F. G. (1998)
  36. F. W. Alt et al. Immunol. Today 13 306 (1992). (10.1016/0167-5699(92)90043-7)
  37. Vanin E. F., Annu. Rev. Genet. 19, 253 (1985). (10.1146/annurev.ge.19.120185.001345) / Annu. Rev. Genet. by Vanin E. F. (1985)
  38. 10.1126/science.7682012
  39. Lunque T., Marfany G., Gonzalez Duarte R., Mol. Biol. Evol. 14, 1316 (1997). (10.1093/oxfordjournals.molbev.a025741) / Mol. Biol. Evol. by Lunque T. (1997)
  40. DeBerardinis R. J., Goodier J. L., Ostertag E. M., Kazazian H. H., Nature Genet. 20, 288 (1998). (10.1038/3104) / Nature Genet. by DeBerardinis R. J. (1998)
  41. We thank M. Kimberland for excellent technical assistance; A. Lotia for assistance with computer graphics; and J. Boeke D. Ginsburg E. Luning Prak J. Goodier and E. Ostertag for critical reading of the manuscript. Supported in part by Damon Runyon Postdoctoral fellowship DRG-1332 (J.V.M.) and NIH grant GM45398 (H.H.K.).
Dates
Type When
Created 23 years, 1 month ago (July 27, 2002, 5:50 a.m.)
Deposited 1 year, 7 months ago (Jan. 13, 2024, 12:02 a.m.)
Indexed 3 weeks, 3 days ago (Aug. 6, 2025, 8:57 a.m.)
Issued 26 years, 5 months ago (March 5, 1999)
Published 26 years, 5 months ago (March 5, 1999)
Published Print 26 years, 5 months ago (March 5, 1999)
Funders 0

None

@article{Moran_1999, title={Exon Shuffling by L1 Retrotransposition}, volume={283}, ISSN={1095-9203}, url={http://dx.doi.org/10.1126/science.283.5407.1530}, DOI={10.1126/science.283.5407.1530}, number={5407}, journal={Science}, publisher={American Association for the Advancement of Science (AAAS)}, author={Moran, John V. and DeBerardinis, Ralph J. and Kazazian, Haig H.}, year={1999}, month=mar, pages={1530–1534} }