DOI: 10.1126/science.281.5375.424. Spatial Organization of Transcription Elongation Complex in <i>Escherichia coli</i>

Spatial Organization of Transcription Elongation Complex in Escherichia coli

10.1126/science.281.5375.424

Crossref journal-article

American Association for the Advancement of Science (AAAS)

Science (221)

Abstract

During RNA synthesis in the ternary elongation complex, RNA polymerase enzyme holds nucleic acids in three contiguous sites: the double-stranded DNA-binding site (DBS) ahead of the transcription bubble, the RNA-DNA heteroduplex-binding site (HBS), and the RNA-binding site (RBS) upstream of HBS. Photochemical cross-linking allowed mapping of the DNA and RNA contacts to specific positions on the amino acid sequence. Unexpectedly, the same protein regions were found to participate in both DBS and RBS. Thus, DNA entry and RNA exit occur close together in the RNA polymerase molecule, suggesting that the three sites constitute a single unit. The results explain how RNA in the integrated unit RBS–HBS–DBS may stabilize the ternary complex, whereas a hairpin in RNA result in its dissociation.

Bibliography

Nudler, E., Gusarov, I., Avetissova, E., Kozlov, M., & Goldfarb, A. (1998). Spatial Organization of Transcription Elongation Complex in Escherichia coli. Science, 281(5375), 424â428.

Authors 5

Evgeny Nudler (first)
Ivan Gusarov (additional)
Ekaterina Avetissova (additional)
Maxim Kozlov (additional)
Alex Goldfarb (additional)

References 22 Referenced 69

Darst S. A., Kubalek E. W., Kornberg R. D., Nature 340, 730 (1989); (10.1038/340730a0) / Nature by Darst S. A. (1989)
Polyakov A., Severinova E., Darst S. A., Cell 83, 365 (1995). (10.1016/0092-8674(95)90114-0) / Cell by Polyakov A. (1995)
10.1126/science.273.5272.211
J. Kurijan and M. O'Donnell J. Mol. Biol. 234 915 (1994).
10.1016/S0092-8674(00)80180-4
S. A. Kumar and J. S. Krakow J. Biol. Chem. 250 2878 (1975). (10.1016/S0021-9258(19)41569-X)
10.1146/annurev.biochem.66.1.117
10.1074/jbc.272.24.15329
E. Nudler et al. unpublished results.
10.1016/S0022-2836(05)80123-8
10.1073/pnas.92.19.8793
10.1016/0092-8674(95)90388-7
Severinov K., et al., J. Biol. Chem. 272, 24137 (1997). (10.1074/jbc.272.39.24137) / J. Biol. Chem. by Severinov K. (1997)
10.1126/science.8503010
Puhler G., et al., Proc. Natl. Acad. Sci. U.S.A. 86, 4569 (1989); (10.1073/pnas.86.12.4569) / Proc. Natl. Acad. Sci. U.S.A. by Puhler G. (1989)
Sweetser D., Nonet M., Young R. A., ibid. 84, 1192 (1987). / ibid. by Sweetser D. (1987)
Borukhov S., et al., J. Biol. Chem. 268, 23477 (1993); (10.1016/S0021-9258(19)49487-8) / J. Biol. Chem. by Borukhov S. (1993)
Severinov K., Goldfarb A., ibid. 269, 31701 (1994). / ibid. by Severinov K. (1994)
10.1073/pnas.93.8.3221
“Azido”-UTP is 5-( p -azidotetrafluoro)benzamido-allil-uridine triphosphate. The complete synthesis of “azido”-UTP will be published elsewhere. 4-thio-UTP was synthesized from 4-thio-UMP (Sigma) as described ( 14 ). 5-Iodo-2′-deoxyuridine containing DNA oligonucleotide was custom synthesized (Oligos Etc. Wilsonville OR).
Walking reactions were as described ( 2 ) except that several positions (+12 +15 +17 +39 +40 +41 +42) in the transcript were radiolabeled with [ 32 P]cytosine monophosphate and [ 32 P]guanosine monophosphate the cross-linking with 4-thio-UMP was induced by UV irradiation at 365 nm as in ( 14 ) the cross-linking with “azido”-UMP was induced by UV irradiation at 308 nm for 5 min and the cross-linking with 5-iodo-2′-deoxyuridine was performed as in ( 2 ). The template used was the T7A1 promoter fragment (153-pb) obtained by polymerase chain reaction with the following transcribed sequence: ATCGAGAGGGACACGGCGAATAGCCATCCCAATCGAACAGGCCTGCTGGTAATCGCAGGCCTGGAGACTTGGATCCCCGGGTA.
We are grateful to O. Bereschenko for help with the figures A. Mustaev for advice on cross-linking techniques and Sergei Borukhov for GreB. This work was supported by NIH grant GM49242 (A.G.) and departmental funds (E.N). E.A. and M.K. are in the graduate programs of the Institute of Molecular Genetics Russian Academy of Sciences and the Limnological Institute (Irkutsk Russia) respectively.

Dates

Type	When
Created	23 years, 1 month ago (July 27, 2002, 5:43 a.m.)
Deposited	1 year, 7 months ago (Jan. 12, 2024, 10:27 p.m.)
Indexed	2 months ago (July 2, 2025, 2:31 p.m.)
Issued	27 years, 1 month ago (July 17, 1998)
Published	27 years, 1 month ago (July 17, 1998)
Published Print	27 years, 1 month ago (July 17, 1998)

Funders 0

None

BibTeX

@article{Nudler_1998, title={Spatial Organization of Transcription Elongation Complex in Escherichia coli}, volume={281}, ISSN={1095-9203}, url={http://dx.doi.org/10.1126/science.281.5375.424}, DOI={10.1126/science.281.5375.424}, number={5375}, journal={Science}, publisher={American Association for the Advancement of Science (AAAS)}, author={Nudler, Evgeny and Gusarov, Ivan and Avetissova, Ekaterina and Kozlov, Maxim and Goldfarb, Alex}, year={1998}, month=jul, pages={424–428} }

JSON

{
  "indexed": {
    "date-parts": [
      [
        2025,
        7,
        2
      ]
    ],
    "date-time": "2025-07-02T18:31:19Z",
    "timestamp": 1751481079381
  },
  "reference-count": 22,
  "publisher": "American Association for the Advancement of Science (AAAS)",
  "issue": "5375",
  "content-domain": {
    "domain": [],
    "crossmark-restriction": false
  },
  "published-print": {
    "date-parts": [
      [
        1998,
        7,
        17
      ]
    ]
  },
  "abstract": "<jats:p>During RNA synthesis in the ternary elongation complex, RNA polymerase enzyme holds nucleic acids in three contiguous sites: the double-stranded DNA-binding site (DBS) ahead of the transcription bubble, the RNA-DNA heteroduplex-binding site (HBS), and the RNA-binding site (RBS) upstream of HBS. Photochemical cross-linking allowed mapping of the DNA and RNA contacts to specific positions on the amino acid sequence. Unexpectedly, the same protein regions were found to participate in both DBS and RBS. Thus, DNA entry and RNA exit occur close together in the RNA polymerase molecule, suggesting that the three sites constitute a single unit. The results explain how RNA in the integrated unit RBS\u2013HBS\u2013DBS may stabilize the ternary complex, whereas a hairpin in RNA result in its dissociation.</jats:p>",
  "DOI": "10.1126/science.281.5375.424",
  "type": "journal-article",
  "created": {
    "date-parts": [
      [
        2002,
        7,
        27
      ]
    ],
    "date-time": "2002-07-27T09:43:20Z",
    "timestamp": 1027763000000
  },
  "page": "424-428",
  "source": "Crossref",
  "is-referenced-by-count": 69,
  "title": "Spatial Organization of Transcription Elongation Complex in\n            <i>Escherichia coli</i>",
  "prefix": "10.1126",
  "volume": "281",
  "author": [
    {
      "given": "Evgeny",
      "family": "Nudler",
      "sequence": "first",
      "affiliation": [
        {
          "name": "E. Nudler and I. Gusarov, Department of Biochemistry, New York University Medical Center, New York, NY 10016, USA. E. Avetissova, M. Kozlov, A. Goldfarb, Public Health Research Institute, New York, NY 10016, USA."
        }
      ]
    },
    {
      "given": "Ivan",
      "family": "Gusarov",
      "sequence": "additional",
      "affiliation": [
        {
          "name": "E. Nudler and I. Gusarov, Department of Biochemistry, New York University Medical Center, New York, NY 10016, USA. E. Avetissova, M. Kozlov, A. Goldfarb, Public Health Research Institute, New York, NY 10016, USA."
        }
      ]
    },
    {
      "given": "Ekaterina",
      "family": "Avetissova",
      "sequence": "additional",
      "affiliation": [
        {
          "name": "E. Nudler and I. Gusarov, Department of Biochemistry, New York University Medical Center, New York, NY 10016, USA. E. Avetissova, M. Kozlov, A. Goldfarb, Public Health Research Institute, New York, NY 10016, USA."
        }
      ]
    },
    {
      "given": "Maxim",
      "family": "Kozlov",
      "sequence": "additional",
      "affiliation": [
        {
          "name": "E. Nudler and I. Gusarov, Department of Biochemistry, New York University Medical Center, New York, NY 10016, USA. E. Avetissova, M. Kozlov, A. Goldfarb, Public Health Research Institute, New York, NY 10016, USA."
        }
      ]
    },
    {
      "given": "Alex",
      "family": "Goldfarb",
      "sequence": "additional",
      "affiliation": [
        {
          "name": "E. Nudler and I. Gusarov, Department of Biochemistry, New York University Medical Center, New York, NY 10016, USA. E. Avetissova, M. Kozlov, A. Goldfarb, Public Health Research Institute, New York, NY 10016, USA."
        }
      ]
    }
  ],
  "member": "221",
  "reference": [
    {
      "key": "e_1_3_1_2_2",
      "doi-asserted-by": "crossref",
      "first-page": "730",
      "DOI": "10.1038/340730a0",
      "volume": "340",
      "author": "Darst S. A.",
      "year": "1989",
      "unstructured": "Darst S. A., Kubalek E. W., Kornberg R. D., Nature 340, 730 (1989);",
      "journal-title": "Nature"
    },
    {
      "key": "e_1_3_1_2_3",
      "doi-asserted-by": "crossref",
      "first-page": "365",
      "DOI": "10.1016/0092-8674(95)90114-0",
      "volume": "83",
      "author": "Polyakov A.",
      "year": "1995",
      "unstructured": "Polyakov A., Severinova E., Darst S. A., Cell 83, 365 (1995).",
      "journal-title": "Cell"
    },
    {
      "key": "e_1_3_1_3_2",
      "doi-asserted-by": "publisher",
      "DOI": "10.1126/science.273.5272.211"
    },
    {
      "key": "e_1_3_1_4_2",
      "unstructured": "J. Kurijan and M. O'Donnell J. Mol. Biol. 234 915 (1994)."
    },
    {
      "key": "e_1_3_1_5_2",
      "doi-asserted-by": "publisher",
      "DOI": "10.1016/S0092-8674(00)80180-4"
    },
    {
      "key": "e_1_3_1_6_2",
      "doi-asserted-by": "crossref",
      "unstructured": "S. A. Kumar and J. S. Krakow J. Biol. Chem. 250 2878 (1975).",
      "DOI": "10.1016/S0021-9258(19)41569-X"
    },
    {
      "key": "e_1_3_1_7_2",
      "doi-asserted-by": "publisher",
      "DOI": "10.1146/annurev.biochem.66.1.117"
    },
    {
      "key": "e_1_3_1_8_2",
      "doi-asserted-by": "publisher",
      "DOI": "10.1074/jbc.272.24.15329"
    },
    {
      "key": "e_1_3_1_9_2",
      "unstructured": "E. Nudler et al. unpublished results."
    },
    {
      "key": "e_1_3_1_10_2",
      "doi-asserted-by": "publisher",
      "DOI": "10.1016/S0022-2836(05)80123-8"
    },
    {
      "key": "e_1_3_1_10_3",
      "doi-asserted-by": "publisher",
      "DOI": "10.1073/pnas.92.19.8793"
    },
    {
      "key": "e_1_3_1_10_4",
      "doi-asserted-by": "publisher",
      "DOI": "10.1016/0092-8674(95)90388-7"
    },
    {
      "key": "e_1_3_1_11_2",
      "doi-asserted-by": "crossref",
      "first-page": "24137",
      "DOI": "10.1074/jbc.272.39.24137",
      "volume": "272",
      "author": "Severinov K.",
      "year": "1997",
      "unstructured": "Severinov K., et al., J. Biol. Chem. 272, 24137 (1997).",
      "journal-title": "J. Biol. Chem."
    },
    {
      "key": "e_1_3_1_12_2",
      "doi-asserted-by": "publisher",
      "DOI": "10.1126/science.8503010"
    },
    {
      "key": "e_1_3_1_13_2",
      "doi-asserted-by": "crossref",
      "first-page": "4569",
      "DOI": "10.1073/pnas.86.12.4569",
      "volume": "86",
      "author": "Puhler G.",
      "year": "1989",
      "unstructured": "Puhler G., et al., Proc. Natl. Acad. Sci. U.S.A. 86, 4569 (1989);",
      "journal-title": "Proc. Natl. Acad. Sci. U.S.A."
    },
    {
      "key": "e_1_3_1_13_3",
      "first-page": "1192",
      "volume": "84",
      "author": "Sweetser D.",
      "year": "1987",
      "unstructured": "Sweetser D., Nonet M., Young R. A., ibid. 84, 1192 (1987).",
      "journal-title": "ibid."
    },
    {
      "key": "e_1_3_1_14_2",
      "doi-asserted-by": "crossref",
      "first-page": "23477",
      "DOI": "10.1016/S0021-9258(19)49487-8",
      "volume": "268",
      "author": "Borukhov S.",
      "year": "1993",
      "unstructured": "Borukhov S., et al., J. Biol. Chem. 268, 23477 (1993);",
      "journal-title": "J. Biol. Chem."
    },
    {
      "key": "e_1_3_1_14_3",
      "first-page": "31701",
      "volume": "269",
      "author": "Severinov K.",
      "year": "1994",
      "unstructured": "Severinov K., Goldfarb A., ibid. 269, 31701 (1994).",
      "journal-title": "ibid."
    },
    {
      "key": "e_1_3_1_15_2",
      "doi-asserted-by": "publisher",
      "DOI": "10.1073/pnas.93.8.3221"
    },
    {
      "key": "e_1_3_1_16_2",
      "unstructured": "\u201cAzido\u201d-UTP is 5-( p -azidotetrafluoro)benzamido-allil-uridine triphosphate. The complete synthesis of \u201cazido\u201d-UTP will be published elsewhere. 4-thio-UTP was synthesized from 4-thio-UMP (Sigma) as described ( 14 ). 5-Iodo-2\u2032-deoxyuridine containing DNA oligonucleotide was custom synthesized (Oligos Etc. Wilsonville OR)."
    },
    {
      "key": "e_1_3_1_17_2",
      "unstructured": "Walking reactions were as described ( 2 ) except that several positions (+12 +15 +17 +39 +40 +41 +42) in the transcript were radiolabeled with [ 32 P]cytosine monophosphate and [ 32 P]guanosine monophosphate the cross-linking with 4-thio-UMP was induced by UV irradiation at 365 nm as in ( 14 ) the cross-linking with \u201cazido\u201d-UMP was induced by UV irradiation at 308 nm for 5 min and the cross-linking with 5-iodo-2\u2032-deoxyuridine was performed as in ( 2 ). The template used was the T7A1 promoter fragment (153-pb) obtained by polymerase chain reaction with the following transcribed sequence: ATCGAGAGGGACACGGCGAATAGCCATCCCAATCGAACAGGCCTGCTGGTAATCGCAGGCCTGGAGACTTGGATCCCCGGGTA."
    },
    {
      "key": "e_1_3_1_18_2",
      "unstructured": "We are grateful to O. Bereschenko for help with the figures A. Mustaev for advice on cross-linking techniques and Sergei Borukhov for GreB. This work was supported by NIH grant GM49242 (A.G.) and departmental funds (E.N). E.A. and M.K. are in the graduate programs of the Institute of Molecular Genetics Russian Academy of Sciences and the Limnological Institute (Irkutsk Russia) respectively."
    }
  ],
  "container-title": "Science",
  "original-title": [],
  "language": "en",
  "link": [
    {
      "URL": "https://www.science.org/doi/pdf/10.1126/science.281.5375.424",
      "content-type": "unspecified",
      "content-version": "vor",
      "intended-application": "similarity-checking"
    }
  ],
  "deposited": {
    "date-parts": [
      [
        2024,
        1,
        13
      ]
    ],
    "date-time": "2024-01-13T03:27:47Z",
    "timestamp": 1705116467000
  },
  "score": 1,
  "resource": {
    "primary": {
      "URL": "https://www.science.org/doi/10.1126/science.281.5375.424"
    }
  },
  "subtitle": [],
  "short-title": [],
  "issued": {
    "date-parts": [
      [
        1998,
        7,
        17
      ]
    ]
  },
  "references-count": 22,
  "journal-issue": {
    "issue": "5375",
    "published-print": {
      "date-parts": [
        [
          1998,
          7,
          17
        ]
      ]
    }
  },
  "alternative-id": [
    "10.1126/science.281.5375.424"
  ],
  "URL": "http://dx.doi.org/10.1126/science.281.5375.424",
  "relation": {},
  "ISSN": [
    "0036-8075",
    "1095-9203"
  ],
  "subject": [],
  "container-title-short": "Science",
  "published": {
    "date-parts": [
      [
        1998,
        7,
        17
      ]
    ]
  }
}