DOI: 10.1126/science.279.5348.242. Frameshift Mutants of β Amyloid Precursor Protein and Ubiquitin-B in Alzheimer's and Down Patients

Frameshift Mutants of β Amyloid Precursor Protein and Ubiquitin-B in Alzheimer's and Down Patients

10.1126/science.279.5348.242

Crossref journal-article

American Association for the Advancement of Science (AAAS)

Science (221)

Abstract

The cerebral cortex of Alzheimer's and Down syndrome patients is characterized by the presence of protein deposits in neurofibrillary tangles, neuritic plaques, and neuropil threads. These structures were shown to contain forms of β amyloid precursor protein and ubiquitin-B that are aberrant (+1 proteins) in the carboxyl terminus. The +1 proteins were not found in young control patients, whereas the presence of ubiquitin-B +1 in elderly control patients may indicate early stages of neurodegeneration. The two species of +1 proteins displayed cellular colocalization, suggesting a common origin, operating at the transcriptional level or by posttranscriptional editing of RNA. This type of transcript mutation is likely an important factor in the widely occurring nonfamilial early- and late-onset forms of Alzheimer's disease.

Bibliography

van Leeuwen, F. W., de Kleijn, D. P. V., van den Hurk, H. H., Neubauer, A., Sonnemans, M. A. F., Sluijs, J. A., KoÌycuÌ, S., Ramdjielal, R. D. J., Salehi, A., Martens, G. J. M., Grosveld, F. G., Burbach, J. P. H., & Hol, E. M. (1998). Frameshift Mutants of Î² Amyloid Precursor Protein and Ubiquitin-B in Alzheimerâs and Down Patients. Science, 279(5348), 242â247.

Authors 13

Fred W. van Leeuwen (first)
Dominique P. V. de Kleijn (additional)
Helma H. van den Hurk (additional)
Andrea Neubauer (additional)
Marc A. F. Sonnemans (additional)
Jacqueline A. Sluijs (additional)
Soner Köycü (additional)
Ravindra D. J. Ramdjielal (additional)
Ahmad Salehi (additional)
Gerard J. M. Martens (additional)
Frank G. Grosveld (additional)
J. Peter H. Burbach (additional)
Elly M. Hol (additional)

References 43 Referenced 469

R. D. Terry E. Masliah L. A. Hansen in Alzheimer Disease R. D. Terry R. Katzman K. L. Bick Eds. (Raven New York 1994) pp. 179–196.
10.1016/S0166-2236(96)01030-2
van Broeckhoven C. L., Eur. Neurol. 35, 8 (1995); (10.1159/000117083) / Eur. Neurol. by van Broeckhoven C. L. (1995)
; R. Tanzi et al. Neurobiol. Dis. 3 159 (1996). (10.1006/nbdi.1996.0016)
Sommer B., Köhler M., Sprengel R., Seeburg P. H., Cell 67, 11 (1991); (10.1016/0092-8674(91)90568-J) / Cell by Sommer B. (1991)
Simpson L., Emeson R. B., Annu. Rev. Neurosci. 19, 27 (1996). (10.1146/annurev.ne.19.030196.000331) / Annu. Rev. Neurosci. by Simpson L. (1996)
Evans D. A. P., van der Kleij A. A. M., Sonnemans M. A. F., Burbach J. P. H., van Leeuwen F. W., Proc. Natl. Acad. Sci. U.S.A. 91, 6059 (1994). (10.1073/pnas.91.13.6059) / Proc. Natl. Acad. Sci. U.S.A. by Evans D. A. P. (1994)
van Leeuwen F., van der Beek E., Seger M., Burbach P., Ivell R., ibid. 86, 6417 (1989). / ibid. by van Leeuwen F. (1989)
Perry G., et al., J. Neurochem. 52, 1523 (1989). (10.1111/j.1471-4159.1989.tb09203.x) / J. Neurochem. by Perry G. (1989)
Jin L. W., et al., J. Neurosci. 14, 5461 (1994). (10.1523/JNEUROSCI.14-09-05461.1994) / J. Neurosci. by Jin L. W. (1994)
Morishima-Kawashima M., et al., Neuron 10, 1151 (1993). (10.1016/0896-6273(93)90063-W) / Neuron by Morishima-Kawashima M. (1993)
Paraffin-embedded and frozen brain material of the cerebral cortex that is the orbitofrontal cortex (area 11) temporal pole (area 38) and hippocampus from nondemented control ( n = 12) AD ( n = 21) and DS ( n = 7) patients was obtained from the Netherlands Brain Bank (coordinator R. Ravid). Informed consent was obtained for the use of autopsy material for research. All brains were neuropathologically investigated (12). The cases were matched for age sex postmortem delay and fixation duration. The Brain Bank also supplied the substantia nigra and striatum of 11 Parkinson patients of whom only one displayed AD neuropathology as well (male 72 years). The +1 peptides (Fig. 1A) were coupled with glutaraldehyde to thyroglobulin mixed in a 1:1 ratio with complete Freunds adjuvant and injected once both intramuscularly and subcutaneously. No homology was found for these peptide sequences in the European Molecular Biology Laboratory database. The affinities were evaluated on nitrocellulose paper with antigen spots and on tissue sections. Paraffin sections (6 μm) were deparaffinized treated in 100% formic acid for 30 min and incubated overnight at 4°C with rabbit antibodies raised to βAPP +1 and Ubi-B +1 (Fig. 1). Antibodies recognizing the more NH 2 -terminal parts of wild-type sequences were used as well. These antibodies include Ubi-B 3-39 (7) recognizing residues 50 to 65 and βAPP 22C11 recognizing residues 66 to 81 [
Hilbich C., Mönning U., Grund C., Masters C. L., Beyreuther K., J. Biol. Chem. 268, 26571 (1993); (10.1016/S0021-9258(19)74350-6) / J. Biol. Chem. by Hilbich C. (1993)
]. Furthermore +1 reading frame antisera to parts of exon 14 (RSPAVAFFWG) (31) and exon 18 (HSSWCGGG) of βAPP were raised and a +2 reading frame antiserum to exon 17 (LDSWWAVLG) was raised. The βAPP +1 and Ubi-B +1 antibodies were diluted 1:250 and 1:400 respectively. The peroxidase-antiperoxidase method was followed (8). In some patients the βAPP +1 and Ubi-B +1 immunolocalizations were matched with Bodian silver Alz-50 and MC-1 staining [
10.1002/(SICI)1097-4547(19970415)48:2<128::AID-JNR5>3.0.CO;2-E
]. When sections were incubated with preimmune serum and with antiserum absorbed with the specific antigen no staining was seen.
A small piece (∼0.1 g) of frozen temporal lobe frontal lobe or hippocampus was homogenized in 0.5 ml of 100% formic acid. The proteins were extracted from the dried samples by boiling for 10 min in 200 μl of 10% SDS. The extract was loaded on a 12.5% SDS-polyacrylamide gel transferred onto nitrocellulose and after an overnight fixation in 5% formaldehyde probed with rabbit antisera to βAPP +1 and Ubi-B +1 (Fig. 1). Additionally antisera were used that recognized residues 229 to 252 of the NH 2 -terminus of βAPP {3H5 [
Philippe B., Brion J.-P., Macq A.-F., Octave J.-N., Neuroreport 5, 289 (1993); (10.1097/00001756-199312000-00027) / Neuroreport by Philippe B. (1993)
]} and residues 50 to 65 of Ubi-B [3 to 39 (7)].
For clinical and pathological information on control and AD patients see
Braak H., et al., J. Neural Transm. 103, 455 (1996). (10.1007/BF01276421) / J. Neural Transm. by Braak H. (1996)
F. W. van Leeuwen et al. data not shown.
As a positive control wild-type βAPP +1 and Ubi-B +1 proteins were expressed in stably transfected AtT20 cells and in bacteria [M15 (pREP4)] respectively. AtT20 cells were stably transfected with βAPP +1 pcDNA3 by electroporation at 260 V and 170 μF. Resistant clones were expanded and assayed for expression of βAPP +1 after the formic acid treatment.
Pieces of frozen human frontal and temporal cortex or hippocampus (CA1 and the subiculum) (∼0.1 g) were homogenized in 1 ml of Trizol (Gibco-BRL) and total RNA was isolated according to the manufacturer's instructions. Total RNA (2 μg) was primed with random hexamers and reverse transcribed with Expand RT. With the Expand High Fidelity PCR system (Boehringer Mannheim) βAPP cDNA (fragments 897 to 1405 of Y00264: 5′ primer GCGGGATCCTGGTGATGAGGTAGAGGAAGAGGCT and 3′ primer CTTACATACAAGCTTAGCATATTGAACACGTGACGAGGCC) and Ubi-B cDNA were amplified (fragments 1094 to 1765 of X04803: 5′ primer GGGGATCCGGTCAAAATGCAGATCTTCGTGAAA and 3′ primer AGAAGAAGCTTTTAACAGCCACCCCTCAGG). The cycle temperature and timing were as follows: for βAPP +1 92°C 30 s; 62°C 30 s; and 72°C 40 s (30 cycles); and for Ubi-B +1 92°C 30 s; 64°C 30 s; and 72°C 40 s (40 cycles). For both PCRs in the last cycle the extension was carried out for 7 min. The amplification products were digested with Bam HI and Hind III and cloned in frame in the expression vector pQE-31. Bacterial clones were screened for mutant proteins with βAPP +1 and Ubi-B +1 antibodies (5). Immunopositive clones were isolated and their inserts were sequenced with Sequenase version 2.0 (USB Cleveland OH) with 35 S-labeled deoxyadenosine triphosphate (dATP).
Paraffin sections (6 μm) were deparaffinized rehydrated and deproteinated for 20 min with 0.2 M HCl followed by a 15-min treatment with proteinase K. The sections were again dehydrated delipidated by a 5-min treatment with chloroform rehydrated and incubated for 20 min in 0.1 M phosphate-buffered saline and 0.1% v/v Triton X-100. Sections were prehybridized with hybridization buffer [30% formamide 0.1 M NaCl 5× Denhardt's solution 10 mM tris-HCl (pH 7.5) 1 mM EDTA 10% dextran sulphate and 50 mM dithiothreitol (DTT)] containing herring sperm DNA (100 μg/ml) and tRNA (500 μg/ml) for 1 hour at room temperature. To detect the βAPP mutant mRNA we labeled a 20-nucleotide oligomer complementary to the βAPP mRNA containing the GA deletion in exon 9 at position 1130 (5′-GGGACATTCTCTCGGTGCTT-3′ corresponding to nucleotides 1123 to 1144) at the 3′ end using terminal deoxynucleotidyl transferase (Boehringer Mannheim) and 35 S-labeled dATP (NEN/Dupont Boston MA) to provide an average tail length of five nucleotides (14). To detect the Ubi-B mutant mRNA we similarly labeled a 20-nucleotide oligomer complementary to the Ubi-B mRNA containing the GT deletion at position 1317 (5′-CGCAGACTCTCCCATACGTC-3′ corresponding to nucleotides 1307 to 1327). The labeled probes were applied to the sections at a concentration of 10 7 counts per milliliter hybridization buffer [βAPP +1 : 30% formamide 0.0125 M NaCl 5× Denhardt's solution 10 mM tris-HCl (pH 7.5) 1 mM EDTA 10% dextran sulfate 50 mM DTT; and Ubi-B +1 : 30% formamide 0.025 M NaCl 5× Denhardt's solution 10 mM tris-HCl (pH 7.5) 1 mM EDTA 10% dextran sulphate and 50 mM DTT]. The sections were incubated under stringent conditions overnight in a humid chamber: βAPP +1 at 38.5°C (hybridization at T m + 15°C) and Ubi-B +1 at 40.5°C (hybridization at T m + 10°C) ( T m is the temperature at which 50% of double-stranded DNA or DNA-RNA hybrids are denatured). Slides were washed once at 55°C in 1× standard saline citrate (SSC) followed by two washings at 55°C in 0.3× SSC. Sections were dehydrated in graded ethanols containing 300 mM ammonium acetate and after drying dipped in NTB-2 photoemulsion (Kodak). After 2 weeks the sections were developed counterstained with hematoxylin dehydrated and mounted.
To check if the dinucleotide deletions in βAPP and Ubi-B occur in the genome or exclusively during transcription we pursued two strategies: (i) genomic PCR with intron primers followed by immunoscreening and (ii) genomic PCR with a 5′ primer that hybridizes only to the complementary DNA template with the mutation and thus can discriminate between the wild-type gene and the mutated gene. In the first strategy genomic DNA was isolated from frozen human brain tissue and amplified with the Expand High Fidelity System (Boehringer Mannheim) with PCR primers recognizing intron sequences adjacent to exons 9 and 10 of βAPP (5′ primer exon 9 5′-GCGGATCCCCTCCTTCTCTTCTACTTTATAG-3′ and 3′ primer exon 9 5′-AGGGGAGCTCGATGGAAGAGCCAGACTTAC-3′; 5′ primer exon 10 5′-AAATTCAAGAGCTCCCTTTATTTATTGGTC-3′ and 3′ primer exon 10 5′-TGTTAAGCTTGAAATGGGTTCAGGTTTTAC-3′). The PCR products were cloned in frame in the Bam HI and Sac I sites (exon 9) or in the Sac I and Hind III sites (exon 10) of the expression vector pQE-31. Ubi-B was amplified with a 5′ primer recognizing the intron sequence adjacent to the start codon (5′-GGGGATCCCGCTTATGTTTTACTTTTAAACAAG-3′) and a 3′ primer recognizing the exon sequence (5′-AGAAGAAGCTTTTAACAGCCACCCCTCAGG-3′ corresponding to nucleotides 1765 to 1783). The cycle temperature and timing were as follows: for βAPP +1 (exon 9) 92°C 30 s; 50°C 30 s; and 72°C 40 s (40 cycles); and for Ubi-B +1 92°C 30 s; 55°C 30 s; and 72°C 40 s (40 cycles). For both PCRs in the last cycle the extension was carried out for 7 min. The Ubi-B fragment was digested with Bam HI and Hind III and cloned in frame in pQE-31 expression vector. Bacterial clones were screened for the production of recombinant proteins as described above. With this method we were able to detect 10 copies of plasmid DNA containing the dinucleotide deletion of βAPP in a background of 100 000 copies of wild-type βAPP DNA. In the second strategy genomic DNA isolated from the frontal cortex of frozen brain material from AD DS and control patients was amplified with a 20-nucleotide oligomer complementary to the βAPP gene containing a GA deletion in exon 9 at position 1135 (5′ primer 5′-AGGCCAAGCACCGAGAGAAT-3′ corresponding to nucleotides 1110 to 1138) and an intron primer (3′ primer 5′-CTGTGGGGAGACTGAGGCAG-3′) hybridizing to the exon 9 adjacent intron sequence. For the mutant Ubi-B gene with a GT deletion in the first repeat we chose an appropriate primer (5′ primer 5′-GGTCCTGCGTCTGAGAGGGT-3′ corresponding to nucleotides 1300 to 1321) and a 3′ primer hybridizing downstream to the polyadenylate signal (3′ primer 5′-GCGTACCCACACATCACTAG-3′ corresponding to nucleotides 1973 to 1954). Genomic DNA (0.5 μg) was amplified by PCR with Goldstar DNA Polymerase (Eurogentec Seraing Belgium) in 0.3 M tris-HCl (pH 9.5) 10 mM deoxynucleotide triphosphate 35 pmol of each primer 7.5 mM MgCl 2 and 75 mM ammonium sulfate. The cycle temperature and timing were as follows: 93°C 1 min and 56°C 1.5 min (35 cycles). In the last cycle the extension was carried out for 10 min. PCR products were checked on a 2% agarose gel {for details see S. Glisic and D. Alavantic [ Trends Genet. 12 391 (1996)]}.
T. Strachan and A. P. Read Human Molecular Genetics (Bios Scientific Oxford UK 1997).
West M. J., Coleman P. D., Flood D. G., Troncoso J. C., Lancet 344, 769 (1994). (10.1016/S0140-6736(94)92338-8) / Lancet by West M. J. (1994)
Neve R. L., Finch E. A., Dawes L. R., Neuron 1, 669 (1988). (10.1016/0896-6273(88)90166-3) / Neuron by Neve R. L. (1988)
Rumble B., et al., N. Engl. J. Med. 320, 1446 (1989). (10.1056/NEJM198906013202203) / N. Engl. J. Med. by Rumble B. (1989)
Oyama F., et al., J. Neurochem. 62, 1062 (1994). (10.1046/j.1471-4159.1994.62031062.x) / J. Neurochem. by Oyama F. (1994)
Harrison P. J., Wighton-Benn W. H., Heffernan J. M., Sanders M. W., Pearson R. C. A., Neurodegeneration 5, 409 (1996). (10.1006/neur.1996.0055) / Neurodegeneration by Harrison P. J. (1996)
Johnston J. A., et al., Mol. Brain Res. 43, 85 (1996). (10.1016/S0169-328X(96)00161-1) / Mol. Brain Res. by Johnston J. A. (1996)
Ali-Khan Z., Normand J., Alizadeh-Khiavi K., Robitaille Y., Chronopoulos S., Neurosci. Lett. 139, 24 (1992). (10.1016/0304-3940(92)90849-3) / Neurosci. Lett. by Ali-Khan Z. (1992)
Hilt W., Wolf D. H., Trends Biochem. Sci. 21, 96 (1996). (10.1016/S0968-0004(96)10012-8) / Trends Biochem. Sci. by Hilt W. (1996)
Lowe J., McDermott H., Landon M., Mayer R. J., Wilkinson K. D., J. Pathol. 161, 153 (1990). (10.1002/path.1711610210) / J. Pathol. by Lowe J. (1990)
Kwak S., Masaki T., Ishiura S., Sugita H., Neurosci. Lett. 128, 21 (1991). (10.1016/0304-3940(91)90751-E) / Neurosci. Lett. by Kwak S. (1991)
F. W. van Leeuwen. J. P. H. Burbach D. Murphy unpublished results.
Single-letter abbreviations for the amino acid residues are as follows: A Ala; C Cys; D Asp; E Glu; F Phe; G Gly; H His; I Ile; K Lys; L Leu; M Met; N Asn; P Pro; Q Gln; R Arg; S Ser; T Thr; V Val; W Trp; and Y Tyr.
Yoshikai S., Sasaki H., Dohura K., Furuya M., Sakaki Y., Gene 87, 257 (1990). (10.1016/0378-1119(90)90310-N) / Gene by Yoshikai S. (1990)
Baker R. T., Board P. G., Nucleic Acids Res. 15, 443 (1987). (10.1093/nar/15.2.443) / Nucleic Acids Res. by Baker R. T. (1987)
10.1038/355632a0
We thank J. Verhaagen D. F. Swaab C. W. Pool J. J. van Heerikhuize T. P. van der Woude J. Wortel A. Holtrop J. Wouda M. Kooreman O. Pach and G. van der Meulen for their help and R. T. Baker I. Grundke-Iqbal P. Davies T. Hartmann and J. M. Octave for generously providing us with plasmid antisera and advice. Supported by Het Stimuleringsfonds Nederlandse Organisatie voor Wetenschappelijk Onderzoek-prioriteitsorogramma Geheugen processenen Dementie an Koninklijke Nederlandse Akademie van Wetenschappen grant the Matty Brand Foundation and the Jan Dekker and Ludgardine Bouwman Foundation.

Dates

Type	When
Created	23 years, 1 month ago (July 27, 2002, 5:42 a.m.)
Deposited	1 year, 7 months ago (Jan. 12, 2024, 11:57 p.m.)
Indexed	15 hours, 5 minutes ago (Sept. 4, 2025, 9:15 a.m.)
Issued	27 years, 7 months ago (Jan. 9, 1998)
Published	27 years, 7 months ago (Jan. 9, 1998)
Published Print	27 years, 7 months ago (Jan. 9, 1998)

Funders 0

None

BibTeX

@article{van_Leeuwen_1998, title={Frameshift Mutants of β Amyloid Precursor Protein and Ubiquitin-B in Alzheimer’s and Down Patients}, volume={279}, ISSN={1095-9203}, url={http://dx.doi.org/10.1126/science.279.5348.242}, DOI={10.1126/science.279.5348.242}, number={5348}, journal={Science}, publisher={American Association for the Advancement of Science (AAAS)}, author={van Leeuwen, Fred W. and de Kleijn, Dominique P. V. and van den Hurk, Helma H. and Neubauer, Andrea and Sonnemans, Marc A. F. and Sluijs, Jacqueline A. and Köycü, Soner and Ramdjielal, Ravindra D. J. and Salehi, Ahmad and Martens, Gerard J. M. and Grosveld, Frank G. and Burbach, J. Peter H. and Hol, Elly M.}, year={1998}, month=jan, pages={242–247} }

JSON

{
  "indexed": {
    "date-parts": [
      [
        2025,
        9,
        4
      ]
    ],
    "date-time": "2025-09-04T13:15:35Z",
    "timestamp": 1756991735427
  },
  "reference-count": 43,
  "publisher": "American Association for the Advancement of Science (AAAS)",
  "issue": "5348",
  "content-domain": {
    "domain": [],
    "crossmark-restriction": false
  },
  "published-print": {
    "date-parts": [
      [
        1998,
        1,
        9
      ]
    ]
  },
  "abstract": "<jats:p>\n            The cerebral cortex of Alzheimer's and Down syndrome patients is characterized by the presence of protein deposits in neurofibrillary tangles, neuritic plaques, and neuropil threads. These structures were shown to contain forms of \u03b2 amyloid precursor protein and ubiquitin-B that are aberrant (+1 proteins) in the carboxyl terminus. The +1 proteins were not found in young control patients, whereas the presence of ubiquitin-B\n            <jats:sup>+1</jats:sup>\n            in elderly control patients may indicate early stages of neurodegeneration. The two species of +1 proteins displayed cellular colocalization, suggesting a common origin, operating at the transcriptional level or by posttranscriptional editing of RNA. This type of transcript mutation is likely an important factor in the widely occurring nonfamilial early- and late-onset forms of Alzheimer's disease.\n          </jats:p>",
  "DOI": "10.1126/science.279.5348.242",
  "type": "journal-article",
  "created": {
    "date-parts": [
      [
        2002,
        7,
        27
      ]
    ],
    "date-time": "2002-07-27T09:42:47Z",
    "timestamp": 1027762967000
  },
  "page": "242-247",
  "source": "Crossref",
  "is-referenced-by-count": 469,
  "title": "Frameshift Mutants of \u03b2 Amyloid Precursor Protein and Ubiquitin-B in Alzheimer's and Down Patients",
  "prefix": "10.1126",
  "volume": "279",
  "author": [
    {
      "given": "Fred W.",
      "family": "van Leeuwen",
      "sequence": "first",
      "affiliation": [
        {
          "name": "F. W. van Leeuwen, D. P. V. de Kleijn, A. Neubauer, M. A. F. Sonnemans, J. A. Sluijs, S. Ko\u0308ycu\u0308, R. D. J. Ramdjielal, A. Salehi, E. M. Hol, Graduate School for Neurosciences Amsterdam, Netherlands Institute for Brain Research, 1105 AZ Amsterdam, Netherlands."
        },
        {
          "name": "H. H. van den Hurk and G. J. M. Martens, Department of Molecular Animal Physiology, University of Nijmegen, 6525 ED Nijmegen, Netherlands."
        },
        {
          "name": "F. G. Grosveld, Department of Cell Biology and Genetics, Erasmus University, 3000 DR Rotterdam, Netherlands."
        },
        {
          "name": "J. P. H. Burbach, Rudolf Magnus Institute for Neurosciences, 3584 CG Utrecht, Netherlands."
        }
      ]
    },
    {
      "given": "Dominique P. V.",
      "family": "de Kleijn",
      "sequence": "additional",
      "affiliation": [
        {
          "name": "F. W. van Leeuwen, D. P. V. de Kleijn, A. Neubauer, M. A. F. Sonnemans, J. A. Sluijs, S. Ko\u0308ycu\u0308, R. D. J. Ramdjielal, A. Salehi, E. M. Hol, Graduate School for Neurosciences Amsterdam, Netherlands Institute for Brain Research, 1105 AZ Amsterdam, Netherlands."
        },
        {
          "name": "H. H. van den Hurk and G. J. M. Martens, Department of Molecular Animal Physiology, University of Nijmegen, 6525 ED Nijmegen, Netherlands."
        },
        {
          "name": "F. G. Grosveld, Department of Cell Biology and Genetics, Erasmus University, 3000 DR Rotterdam, Netherlands."
        },
        {
          "name": "J. P. H. Burbach, Rudolf Magnus Institute for Neurosciences, 3584 CG Utrecht, Netherlands."
        }
      ]
    },
    {
      "given": "Helma H.",
      "family": "van den Hurk",
      "sequence": "additional",
      "affiliation": [
        {
          "name": "F. W. van Leeuwen, D. P. V. de Kleijn, A. Neubauer, M. A. F. Sonnemans, J. A. Sluijs, S. Ko\u0308ycu\u0308, R. D. J. Ramdjielal, A. Salehi, E. M. Hol, Graduate School for Neurosciences Amsterdam, Netherlands Institute for Brain Research, 1105 AZ Amsterdam, Netherlands."
        },
        {
          "name": "H. H. van den Hurk and G. J. M. Martens, Department of Molecular Animal Physiology, University of Nijmegen, 6525 ED Nijmegen, Netherlands."
        },
        {
          "name": "F. G. Grosveld, Department of Cell Biology and Genetics, Erasmus University, 3000 DR Rotterdam, Netherlands."
        },
        {
          "name": "J. P. H. Burbach, Rudolf Magnus Institute for Neurosciences, 3584 CG Utrecht, Netherlands."
        }
      ]
    },
    {
      "given": "Andrea",
      "family": "Neubauer",
      "sequence": "additional",
      "affiliation": [
        {
          "name": "F. W. van Leeuwen, D. P. V. de Kleijn, A. Neubauer, M. A. F. Sonnemans, J. A. Sluijs, S. Ko\u0308ycu\u0308, R. D. J. Ramdjielal, A. Salehi, E. M. Hol, Graduate School for Neurosciences Amsterdam, Netherlands Institute for Brain Research, 1105 AZ Amsterdam, Netherlands."
        },
        {
          "name": "H. H. van den Hurk and G. J. M. Martens, Department of Molecular Animal Physiology, University of Nijmegen, 6525 ED Nijmegen, Netherlands."
        },
        {
          "name": "F. G. Grosveld, Department of Cell Biology and Genetics, Erasmus University, 3000 DR Rotterdam, Netherlands."
        },
        {
          "name": "J. P. H. Burbach, Rudolf Magnus Institute for Neurosciences, 3584 CG Utrecht, Netherlands."
        }
      ]
    },
    {
      "given": "Marc A. F.",
      "family": "Sonnemans",
      "sequence": "additional",
      "affiliation": [
        {
          "name": "F. W. van Leeuwen, D. P. V. de Kleijn, A. Neubauer, M. A. F. Sonnemans, J. A. Sluijs, S. Ko\u0308ycu\u0308, R. D. J. Ramdjielal, A. Salehi, E. M. Hol, Graduate School for Neurosciences Amsterdam, Netherlands Institute for Brain Research, 1105 AZ Amsterdam, Netherlands."
        },
        {
          "name": "H. H. van den Hurk and G. J. M. Martens, Department of Molecular Animal Physiology, University of Nijmegen, 6525 ED Nijmegen, Netherlands."
        },
        {
          "name": "F. G. Grosveld, Department of Cell Biology and Genetics, Erasmus University, 3000 DR Rotterdam, Netherlands."
        },
        {
          "name": "J. P. H. Burbach, Rudolf Magnus Institute for Neurosciences, 3584 CG Utrecht, Netherlands."
        }
      ]
    },
    {
      "given": "Jacqueline A.",
      "family": "Sluijs",
      "sequence": "additional",
      "affiliation": [
        {
          "name": "F. W. van Leeuwen, D. P. V. de Kleijn, A. Neubauer, M. A. F. Sonnemans, J. A. Sluijs, S. Ko\u0308ycu\u0308, R. D. J. Ramdjielal, A. Salehi, E. M. Hol, Graduate School for Neurosciences Amsterdam, Netherlands Institute for Brain Research, 1105 AZ Amsterdam, Netherlands."
        },
        {
          "name": "H. H. van den Hurk and G. J. M. Martens, Department of Molecular Animal Physiology, University of Nijmegen, 6525 ED Nijmegen, Netherlands."
        },
        {
          "name": "F. G. Grosveld, Department of Cell Biology and Genetics, Erasmus University, 3000 DR Rotterdam, Netherlands."
        },
        {
          "name": "J. P. H. Burbach, Rudolf Magnus Institute for Neurosciences, 3584 CG Utrecht, Netherlands."
        }
      ]
    },
    {
      "given": "Soner",
      "family": "Ko\u0308ycu\u0308",
      "sequence": "additional",
      "affiliation": [
        {
          "name": "F. W. van Leeuwen, D. P. V. de Kleijn, A. Neubauer, M. A. F. Sonnemans, J. A. Sluijs, S. Ko\u0308ycu\u0308, R. D. J. Ramdjielal, A. Salehi, E. M. Hol, Graduate School for Neurosciences Amsterdam, Netherlands Institute for Brain Research, 1105 AZ Amsterdam, Netherlands."
        },
        {
          "name": "H. H. van den Hurk and G. J. M. Martens, Department of Molecular Animal Physiology, University of Nijmegen, 6525 ED Nijmegen, Netherlands."
        },
        {
          "name": "F. G. Grosveld, Department of Cell Biology and Genetics, Erasmus University, 3000 DR Rotterdam, Netherlands."
        },
        {
          "name": "J. P. H. Burbach, Rudolf Magnus Institute for Neurosciences, 3584 CG Utrecht, Netherlands."
        }
      ]
    },
    {
      "given": "Ravindra D. J.",
      "family": "Ramdjielal",
      "sequence": "additional",
      "affiliation": [
        {
          "name": "F. W. van Leeuwen, D. P. V. de Kleijn, A. Neubauer, M. A. F. Sonnemans, J. A. Sluijs, S. Ko\u0308ycu\u0308, R. D. J. Ramdjielal, A. Salehi, E. M. Hol, Graduate School for Neurosciences Amsterdam, Netherlands Institute for Brain Research, 1105 AZ Amsterdam, Netherlands."
        },
        {
          "name": "H. H. van den Hurk and G. J. M. Martens, Department of Molecular Animal Physiology, University of Nijmegen, 6525 ED Nijmegen, Netherlands."
        },
        {
          "name": "F. G. Grosveld, Department of Cell Biology and Genetics, Erasmus University, 3000 DR Rotterdam, Netherlands."
        },
        {
          "name": "J. P. H. Burbach, Rudolf Magnus Institute for Neurosciences, 3584 CG Utrecht, Netherlands."
        }
      ]
    },
    {
      "given": "Ahmad",
      "family": "Salehi",
      "sequence": "additional",
      "affiliation": [
        {
          "name": "F. W. van Leeuwen, D. P. V. de Kleijn, A. Neubauer, M. A. F. Sonnemans, J. A. Sluijs, S. Ko\u0308ycu\u0308, R. D. J. Ramdjielal, A. Salehi, E. M. Hol, Graduate School for Neurosciences Amsterdam, Netherlands Institute for Brain Research, 1105 AZ Amsterdam, Netherlands."
        },
        {
          "name": "H. H. van den Hurk and G. J. M. Martens, Department of Molecular Animal Physiology, University of Nijmegen, 6525 ED Nijmegen, Netherlands."
        },
        {
          "name": "F. G. Grosveld, Department of Cell Biology and Genetics, Erasmus University, 3000 DR Rotterdam, Netherlands."
        },
        {
          "name": "J. P. H. Burbach, Rudolf Magnus Institute for Neurosciences, 3584 CG Utrecht, Netherlands."
        }
      ]
    },
    {
      "given": "Gerard J. M.",
      "family": "Martens",
      "sequence": "additional",
      "affiliation": [
        {
          "name": "F. W. van Leeuwen, D. P. V. de Kleijn, A. Neubauer, M. A. F. Sonnemans, J. A. Sluijs, S. Ko\u0308ycu\u0308, R. D. J. Ramdjielal, A. Salehi, E. M. Hol, Graduate School for Neurosciences Amsterdam, Netherlands Institute for Brain Research, 1105 AZ Amsterdam, Netherlands."
        },
        {
          "name": "H. H. van den Hurk and G. J. M. Martens, Department of Molecular Animal Physiology, University of Nijmegen, 6525 ED Nijmegen, Netherlands."
        },
        {
          "name": "F. G. Grosveld, Department of Cell Biology and Genetics, Erasmus University, 3000 DR Rotterdam, Netherlands."
        },
        {
          "name": "J. P. H. Burbach, Rudolf Magnus Institute for Neurosciences, 3584 CG Utrecht, Netherlands."
        }
      ]
    },
    {
      "given": "Frank G.",
      "family": "Grosveld",
      "sequence": "additional",
      "affiliation": [
        {
          "name": "F. W. van Leeuwen, D. P. V. de Kleijn, A. Neubauer, M. A. F. Sonnemans, J. A. Sluijs, S. Ko\u0308ycu\u0308, R. D. J. Ramdjielal, A. Salehi, E. M. Hol, Graduate School for Neurosciences Amsterdam, Netherlands Institute for Brain Research, 1105 AZ Amsterdam, Netherlands."
        },
        {
          "name": "H. H. van den Hurk and G. J. M. Martens, Department of Molecular Animal Physiology, University of Nijmegen, 6525 ED Nijmegen, Netherlands."
        },
        {
          "name": "F. G. Grosveld, Department of Cell Biology and Genetics, Erasmus University, 3000 DR Rotterdam, Netherlands."
        },
        {
          "name": "J. P. H. Burbach, Rudolf Magnus Institute for Neurosciences, 3584 CG Utrecht, Netherlands."
        }
      ]
    },
    {
      "given": "J. Peter H.",
      "family": "Burbach",
      "sequence": "additional",
      "affiliation": [
        {
          "name": "F. W. van Leeuwen, D. P. V. de Kleijn, A. Neubauer, M. A. F. Sonnemans, J. A. Sluijs, S. Ko\u0308ycu\u0308, R. D. J. Ramdjielal, A. Salehi, E. M. Hol, Graduate School for Neurosciences Amsterdam, Netherlands Institute for Brain Research, 1105 AZ Amsterdam, Netherlands."
        },
        {
          "name": "H. H. van den Hurk and G. J. M. Martens, Department of Molecular Animal Physiology, University of Nijmegen, 6525 ED Nijmegen, Netherlands."
        },
        {
          "name": "F. G. Grosveld, Department of Cell Biology and Genetics, Erasmus University, 3000 DR Rotterdam, Netherlands."
        },
        {
          "name": "J. P. H. Burbach, Rudolf Magnus Institute for Neurosciences, 3584 CG Utrecht, Netherlands."
        }
      ]
    },
    {
      "given": "Elly M.",
      "family": "Hol",
      "sequence": "additional",
      "affiliation": [
        {
          "name": "F. W. van Leeuwen, D. P. V. de Kleijn, A. Neubauer, M. A. F. Sonnemans, J. A. Sluijs, S. Ko\u0308ycu\u0308, R. D. J. Ramdjielal, A. Salehi, E. M. Hol, Graduate School for Neurosciences Amsterdam, Netherlands Institute for Brain Research, 1105 AZ Amsterdam, Netherlands."
        },
        {
          "name": "H. H. van den Hurk and G. J. M. Martens, Department of Molecular Animal Physiology, University of Nijmegen, 6525 ED Nijmegen, Netherlands."
        },
        {
          "name": "F. G. Grosveld, Department of Cell Biology and Genetics, Erasmus University, 3000 DR Rotterdam, Netherlands."
        },
        {
          "name": "J. P. H. Burbach, Rudolf Magnus Institute for Neurosciences, 3584 CG Utrecht, Netherlands."
        }
      ]
    }
  ],
  "member": "221",
  "reference": [
    {
      "key": "e_1_3_1_2_2",
      "unstructured": "R. D. Terry E. Masliah L. A. Hansen in Alzheimer Disease R. D. Terry R. Katzman K. L. Bick Eds. (Raven New York 1994) pp. 179\u2013196."
    },
    {
      "key": "e_1_3_1_3_2",
      "doi-asserted-by": "publisher",
      "DOI": "10.1016/S0166-2236(96)01030-2"
    },
    {
      "key": "e_1_3_1_4_2",
      "doi-asserted-by": "crossref",
      "first-page": "8",
      "DOI": "10.1159/000117083",
      "volume": "35",
      "author": "van Broeckhoven C. L.",
      "year": "1995",
      "unstructured": "van Broeckhoven C. L., Eur. Neurol. 35, 8 (1995);",
      "journal-title": "Eur. Neurol."
    },
    {
      "key": "e_1_3_1_4_3",
      "doi-asserted-by": "crossref",
      "unstructured": "; R. Tanzi et al. Neurobiol. Dis. 3 159 (1996).",
      "DOI": "10.1006/nbdi.1996.0016"
    },
    {
      "key": "e_1_3_1_5_2",
      "doi-asserted-by": "crossref",
      "first-page": "11",
      "DOI": "10.1016/0092-8674(91)90568-J",
      "volume": "67",
      "author": "Sommer B.",
      "year": "1991",
      "unstructured": "Sommer B., K\u00f6hler M., Sprengel R., Seeburg P. H., Cell 67, 11 (1991);",
      "journal-title": "Cell"
    },
    {
      "key": "e_1_3_1_5_3",
      "doi-asserted-by": "crossref",
      "first-page": "27",
      "DOI": "10.1146/annurev.ne.19.030196.000331",
      "volume": "19",
      "author": "Simpson L.",
      "year": "1996",
      "unstructured": "Simpson L., Emeson R. B., Annu. Rev. Neurosci. 19, 27 (1996).",
      "journal-title": "Annu. Rev. Neurosci."
    },
    {
      "key": "e_1_3_1_6_2",
      "doi-asserted-by": "crossref",
      "first-page": "6059",
      "DOI": "10.1073/pnas.91.13.6059",
      "volume": "91",
      "author": "Evans D. A. P.",
      "year": "1994",
      "unstructured": "Evans D. A. P., van der Kleij A. A. M., Sonnemans M. A. F., Burbach J. P. H., van Leeuwen F. W., Proc. Natl. Acad. Sci. U.S.A. 91, 6059 (1994).",
      "journal-title": "Proc. Natl. Acad. Sci. U.S.A."
    },
    {
      "key": "e_1_3_1_7_2",
      "first-page": "6417",
      "volume": "86",
      "author": "van Leeuwen F.",
      "year": "1989",
      "unstructured": "van Leeuwen F., van der Beek E., Seger M., Burbach P., Ivell R., ibid. 86, 6417 (1989).",
      "journal-title": "ibid."
    },
    {
      "key": "e_1_3_1_8_2",
      "doi-asserted-by": "crossref",
      "first-page": "1523",
      "DOI": "10.1111/j.1471-4159.1989.tb09203.x",
      "volume": "52",
      "author": "Perry G.",
      "year": "1989",
      "unstructured": "Perry G., et al., J. Neurochem. 52, 1523 (1989).",
      "journal-title": "J. Neurochem."
    },
    {
      "key": "e_1_3_1_9_2",
      "doi-asserted-by": "crossref",
      "first-page": "5461",
      "DOI": "10.1523/JNEUROSCI.14-09-05461.1994",
      "volume": "14",
      "author": "Jin L. W.",
      "year": "1994",
      "unstructured": "Jin L. W., et al., J. Neurosci. 14, 5461 (1994).",
      "journal-title": "J. Neurosci."
    },
    {
      "key": "e_1_3_1_10_2",
      "doi-asserted-by": "crossref",
      "first-page": "1151",
      "DOI": "10.1016/0896-6273(93)90063-W",
      "volume": "10",
      "author": "Morishima-Kawashima M.",
      "year": "1993",
      "unstructured": "Morishima-Kawashima M., et al., Neuron 10, 1151 (1993).",
      "journal-title": "Neuron"
    },
    {
      "key": "e_1_3_1_11_2",
      "unstructured": "Paraffin-embedded and frozen brain material of the cerebral cortex that is the orbitofrontal cortex (area 11) temporal pole (area 38) and hippocampus from nondemented control ( n = 12) AD ( n = 21) and DS ( n = 7) patients was obtained from the Netherlands Brain Bank (coordinator R. Ravid). Informed consent was obtained for the use of autopsy material for research. All brains were neuropathologically investigated (12). The cases were matched for age sex postmortem delay and fixation duration. The Brain Bank also supplied the substantia nigra and striatum of 11 Parkinson patients of whom only one displayed AD neuropathology as well (male 72 years). The +1 peptides (Fig. 1A) were coupled with glutaraldehyde to thyroglobulin mixed in a 1:1 ratio with complete Freunds adjuvant and injected once both intramuscularly and subcutaneously. No homology was found for these peptide sequences in the European Molecular Biology Laboratory database. The affinities were evaluated on nitrocellulose paper with antigen spots and on tissue sections. Paraffin sections (6 \u03bcm) were deparaffinized treated in 100% formic acid for 30 min and incubated overnight at 4\u00b0C with rabbit antibodies raised to \u03b2APP +1 and Ubi-B +1 (Fig. 1). Antibodies recognizing the more NH 2 -terminal parts of wild-type sequences were used as well. These antibodies include Ubi-B 3-39 (7) recognizing residues 50 to 65 and \u03b2APP 22C11 recognizing residues 66 to 81 ["
    },
    {
      "key": "e_1_3_1_11_3",
      "doi-asserted-by": "crossref",
      "first-page": "26571",
      "DOI": "10.1016/S0021-9258(19)74350-6",
      "volume": "268",
      "author": "Hilbich C.",
      "year": "1993",
      "unstructured": "Hilbich C., M\u00f6nning U., Grund C., Masters C. L., Beyreuther K., J. Biol. Chem. 268, 26571 (1993);",
      "journal-title": "J. Biol. Chem."
    },
    {
      "key": "e_1_3_1_11_4",
      "unstructured": "]. Furthermore +1 reading frame antisera to parts of exon 14 (RSPAVAFFWG) (31) and exon 18 (HSSWCGGG) of \u03b2APP were raised and a +2 reading frame antiserum to exon 17 (LDSWWAVLG) was raised. The \u03b2APP +1 and Ubi-B +1 antibodies were diluted 1:250 and 1:400 respectively. The peroxidase-antiperoxidase method was followed (8). In some patients the \u03b2APP +1 and Ubi-B +1 immunolocalizations were matched with Bodian silver Alz-50 and MC-1 staining ["
    },
    {
      "key": "e_1_3_1_11_5",
      "doi-asserted-by": "publisher",
      "DOI": "10.1002/(SICI)1097-4547(19970415)48:2<128::AID-JNR5>3.0.CO;2-E"
    },
    {
      "key": "e_1_3_1_11_6",
      "unstructured": "]. When sections were incubated with preimmune serum and with antiserum absorbed with the specific antigen no staining was seen."
    },
    {
      "key": "e_1_3_1_12_2",
      "unstructured": "A small piece (\u223c0.1 g) of frozen temporal lobe frontal lobe or hippocampus was homogenized in 0.5 ml of 100% formic acid. The proteins were extracted from the dried samples by boiling for 10 min in 200 \u03bcl of 10% SDS. The extract was loaded on a 12.5% SDS-polyacrylamide gel transferred onto nitrocellulose and after an overnight fixation in 5% formaldehyde probed with rabbit antisera to \u03b2APP +1 and Ubi-B +1 (Fig. 1). Additionally antisera were used that recognized residues 229 to 252 of the NH 2 -terminus of \u03b2APP {3H5 ["
    },
    {
      "key": "e_1_3_1_12_3",
      "doi-asserted-by": "crossref",
      "first-page": "289",
      "DOI": "10.1097/00001756-199312000-00027",
      "volume": "5",
      "author": "Philippe B.",
      "year": "1993",
      "unstructured": "Philippe B., Brion J.-P., Macq A.-F., Octave J.-N., Neuroreport 5, 289 (1993);",
      "journal-title": "Neuroreport"
    },
    {
      "key": "e_1_3_1_12_4",
      "unstructured": "]} and residues 50 to 65 of Ubi-B [3 to 39 (7)]."
    },
    {
      "key": "e_1_3_1_13_2",
      "unstructured": "For clinical and pathological information on control and AD patients see"
    },
    {
      "key": "e_1_3_1_14_2",
      "doi-asserted-by": "crossref",
      "first-page": "455",
      "DOI": "10.1007/BF01276421",
      "volume": "103",
      "author": "Braak H.",
      "year": "1996",
      "unstructured": "Braak H., et al., J. Neural Transm. 103, 455 (1996).",
      "journal-title": "J. Neural Transm."
    },
    {
      "key": "e_1_3_1_15_2",
      "unstructured": "F. W. van Leeuwen et al. data not shown."
    },
    {
      "key": "e_1_3_1_16_2",
      "unstructured": "As a positive control wild-type \u03b2APP +1 and Ubi-B +1 proteins were expressed in stably transfected AtT20 cells and in bacteria [M15 (pREP4)] respectively. AtT20 cells were stably transfected with \u03b2APP +1 pcDNA3 by electroporation at 260 V and 170 \u03bcF. Resistant clones were expanded and assayed for expression of \u03b2APP +1 after the formic acid treatment."
    },
    {
      "key": "e_1_3_1_17_2",
      "unstructured": "Pieces of frozen human frontal and temporal cortex or hippocampus (CA1 and the subiculum) (\u223c0.1 g) were homogenized in 1 ml of Trizol (Gibco-BRL) and total RNA was isolated according to the manufacturer's instructions. Total RNA (2 \u03bcg) was primed with random hexamers and reverse transcribed with Expand RT. With the Expand High Fidelity PCR system (Boehringer Mannheim) \u03b2APP cDNA (fragments 897 to 1405 of Y00264: 5\u2032 primer GCGGGATCCTGGTGATGAGGTAGAGGAAGAGGCT and 3\u2032 primer CTTACATACAAGCTTAGCATATTGAACACGTGACGAGGCC) and Ubi-B cDNA were amplified (fragments 1094 to 1765 of X04803: 5\u2032 primer GGGGATCCGGTCAAAATGCAGATCTTCGTGAAA and 3\u2032 primer AGAAGAAGCTTTTAACAGCCACCCCTCAGG). The cycle temperature and timing were as follows: for \u03b2APP +1 92\u00b0C 30 s; 62\u00b0C 30 s; and 72\u00b0C 40 s (30 cycles); and for Ubi-B +1 92\u00b0C 30 s; 64\u00b0C 30 s; and 72\u00b0C 40 s (40 cycles). For both PCRs in the last cycle the extension was carried out for 7 min. The amplification products were digested with Bam HI and Hind III and cloned in frame in the expression vector pQE-31. Bacterial clones were screened for mutant proteins with \u03b2APP +1 and Ubi-B +1 antibodies (5). Immunopositive clones were isolated and their inserts were sequenced with Sequenase version 2.0 (USB Cleveland OH) with 35 S-labeled deoxyadenosine triphosphate (dATP)."
    },
    {
      "key": "e_1_3_1_18_2",
      "unstructured": "Paraffin sections (6 \u03bcm) were deparaffinized rehydrated and deproteinated for 20 min with 0.2 M HCl followed by a 15-min treatment with proteinase K. The sections were again dehydrated delipidated by a 5-min treatment with chloroform rehydrated and incubated for 20 min in 0.1 M phosphate-buffered saline and 0.1% v/v Triton X-100. Sections were prehybridized with hybridization buffer [30% formamide 0.1 M NaCl 5\u00d7 Denhardt's solution 10 mM tris-HCl (pH 7.5) 1 mM EDTA 10% dextran sulphate and 50 mM dithiothreitol (DTT)] containing herring sperm DNA (100 \u03bcg/ml) and tRNA (500 \u03bcg/ml) for 1 hour at room temperature. To detect the \u03b2APP mutant mRNA we labeled a 20-nucleotide oligomer complementary to the \u03b2APP mRNA containing the GA deletion in exon 9 at position 1130 (5\u2032-GGGACATTCTCTCGGTGCTT-3\u2032 corresponding to nucleotides 1123 to 1144) at the 3\u2032 end using terminal deoxynucleotidyl transferase (Boehringer Mannheim) and 35 S-labeled dATP (NEN/Dupont Boston MA) to provide an average tail length of five nucleotides (14). To detect the Ubi-B mutant mRNA we similarly labeled a 20-nucleotide oligomer complementary to the Ubi-B mRNA containing the GT deletion at position 1317 (5\u2032-CGCAGACTCTCCCATACGTC-3\u2032 corresponding to nucleotides 1307 to 1327). The labeled probes were applied to the sections at a concentration of 10 7 counts per milliliter hybridization buffer [\u03b2APP +1 : 30% formamide 0.0125 M NaCl 5\u00d7 Denhardt's solution 10 mM tris-HCl (pH 7.5) 1 mM EDTA 10% dextran sulfate 50 mM DTT; and Ubi-B +1 : 30% formamide 0.025 M NaCl 5\u00d7 Denhardt's solution 10 mM tris-HCl (pH 7.5) 1 mM EDTA 10% dextran sulphate and 50 mM DTT]. The sections were incubated under stringent conditions overnight in a humid chamber: \u03b2APP +1 at 38.5\u00b0C (hybridization at T m + 15\u00b0C) and Ubi-B +1 at 40.5\u00b0C (hybridization at T m + 10\u00b0C) ( T m is the temperature at which 50% of double-stranded DNA or DNA-RNA hybrids are denatured). Slides were washed once at 55\u00b0C in 1\u00d7 standard saline citrate (SSC) followed by two washings at 55\u00b0C in 0.3\u00d7 SSC. Sections were dehydrated in graded ethanols containing 300 mM ammonium acetate and after drying dipped in NTB-2 photoemulsion (Kodak). After 2 weeks the sections were developed counterstained with hematoxylin dehydrated and mounted."
    },
    {
      "key": "e_1_3_1_19_2",
      "unstructured": "To check if the dinucleotide deletions in \u03b2APP and Ubi-B occur in the genome or exclusively during transcription we pursued two strategies: (i) genomic PCR with intron primers followed by immunoscreening and (ii) genomic PCR with a 5\u2032 primer that hybridizes only to the complementary DNA template with the mutation and thus can discriminate between the wild-type gene and the mutated gene. In the first strategy genomic DNA was isolated from frozen human brain tissue and amplified with the Expand High Fidelity System (Boehringer Mannheim) with PCR primers recognizing intron sequences adjacent to exons 9 and 10 of \u03b2APP (5\u2032 primer exon 9 5\u2032-GCGGATCCCCTCCTTCTCTTCTACTTTATAG-3\u2032 and 3\u2032 primer exon 9 5\u2032-AGGGGAGCTCGATGGAAGAGCCAGACTTAC-3\u2032; 5\u2032 primer exon 10 5\u2032-AAATTCAAGAGCTCCCTTTATTTATTGGTC-3\u2032 and 3\u2032 primer exon 10 5\u2032-TGTTAAGCTTGAAATGGGTTCAGGTTTTAC-3\u2032). The PCR products were cloned in frame in the Bam HI and Sac I sites (exon 9) or in the Sac I and Hind III sites (exon 10) of the expression vector pQE-31. Ubi-B was amplified with a 5\u2032 primer recognizing the intron sequence adjacent to the start codon (5\u2032-GGGGATCCCGCTTATGTTTTACTTTTAAACAAG-3\u2032) and a 3\u2032 primer recognizing the exon sequence (5\u2032-AGAAGAAGCTTTTAACAGCCACCCCTCAGG-3\u2032 corresponding to nucleotides 1765 to 1783). The cycle temperature and timing were as follows: for \u03b2APP +1 (exon 9) 92\u00b0C 30 s; 50\u00b0C 30 s; and 72\u00b0C 40 s (40 cycles); and for Ubi-B +1 92\u00b0C 30 s; 55\u00b0C 30 s; and 72\u00b0C 40 s (40 cycles). For both PCRs in the last cycle the extension was carried out for 7 min. The Ubi-B fragment was digested with Bam HI and Hind III and cloned in frame in pQE-31 expression vector. Bacterial clones were screened for the production of recombinant proteins as described above. With this method we were able to detect 10 copies of plasmid DNA containing the dinucleotide deletion of \u03b2APP in a background of 100 000 copies of wild-type \u03b2APP DNA. In the second strategy genomic DNA isolated from the frontal cortex of frozen brain material from AD DS and control patients was amplified with a 20-nucleotide oligomer complementary to the \u03b2APP gene containing a GA deletion in exon 9 at position 1135 (5\u2032 primer 5\u2032-AGGCCAAGCACCGAGAGAAT-3\u2032 corresponding to nucleotides 1110 to 1138) and an intron primer (3\u2032 primer 5\u2032-CTGTGGGGAGACTGAGGCAG-3\u2032) hybridizing to the exon 9 adjacent intron sequence. For the mutant Ubi-B gene with a GT deletion in the first repeat we chose an appropriate primer (5\u2032 primer 5\u2032-GGTCCTGCGTCTGAGAGGGT-3\u2032 corresponding to nucleotides 1300 to 1321) and a 3\u2032 primer hybridizing downstream to the polyadenylate signal (3\u2032 primer 5\u2032-GCGTACCCACACATCACTAG-3\u2032 corresponding to nucleotides 1973 to 1954). Genomic DNA (0.5 \u03bcg) was amplified by PCR with Goldstar DNA Polymerase (Eurogentec Seraing Belgium) in 0.3 M tris-HCl (pH 9.5) 10 mM deoxynucleotide triphosphate 35 pmol of each primer 7.5 mM MgCl 2 and 75 mM ammonium sulfate. The cycle temperature and timing were as follows: 93\u00b0C 1 min and 56\u00b0C 1.5 min (35 cycles). In the last cycle the extension was carried out for 10 min. PCR products were checked on a 2% agarose gel {for details see S. Glisic and D. Alavantic [ Trends Genet. 12 391 (1996)]}."
    },
    {
      "key": "e_1_3_1_20_2",
      "unstructured": "T. Strachan and A. P. Read Human Molecular Genetics (Bios Scientific Oxford UK 1997)."
    },
    {
      "key": "e_1_3_1_21_2",
      "doi-asserted-by": "crossref",
      "first-page": "769",
      "DOI": "10.1016/S0140-6736(94)92338-8",
      "volume": "344",
      "author": "West M. J.",
      "year": "1994",
      "unstructured": "West M. J., Coleman P. D., Flood D. G., Troncoso J. C., Lancet 344, 769 (1994).",
      "journal-title": "Lancet"
    },
    {
      "key": "e_1_3_1_22_2",
      "doi-asserted-by": "crossref",
      "first-page": "669",
      "DOI": "10.1016/0896-6273(88)90166-3",
      "volume": "1",
      "author": "Neve R. L.",
      "year": "1988",
      "unstructured": "Neve R. L., Finch E. A., Dawes L. R., Neuron 1, 669 (1988).",
      "journal-title": "Neuron"
    },
    {
      "key": "e_1_3_1_23_2",
      "doi-asserted-by": "crossref",
      "first-page": "1446",
      "DOI": "10.1056/NEJM198906013202203",
      "volume": "320",
      "author": "Rumble B.",
      "year": "1989",
      "unstructured": "Rumble B., et al., N. Engl. J. Med. 320, 1446 (1989).",
      "journal-title": "N. Engl. J. Med."
    },
    {
      "key": "e_1_3_1_24_2",
      "doi-asserted-by": "crossref",
      "first-page": "1062",
      "DOI": "10.1046/j.1471-4159.1994.62031062.x",
      "volume": "62",
      "author": "Oyama F.",
      "year": "1994",
      "unstructured": "Oyama F., et al., J. Neurochem. 62, 1062 (1994).",
      "journal-title": "J. Neurochem."
    },
    {
      "key": "e_1_3_1_25_2",
      "doi-asserted-by": "crossref",
      "first-page": "409",
      "DOI": "10.1006/neur.1996.0055",
      "volume": "5",
      "author": "Harrison P. J.",
      "year": "1996",
      "unstructured": "Harrison P. J., Wighton-Benn W. H., Heffernan J. M., Sanders M. W., Pearson R. C. A., Neurodegeneration 5, 409 (1996).",
      "journal-title": "Neurodegeneration"
    },
    {
      "key": "e_1_3_1_26_2",
      "doi-asserted-by": "crossref",
      "first-page": "85",
      "DOI": "10.1016/S0169-328X(96)00161-1",
      "volume": "43",
      "author": "Johnston J. A.",
      "year": "1996",
      "unstructured": "Johnston J. A., et al., Mol. Brain Res. 43, 85 (1996).",
      "journal-title": "Mol. Brain Res."
    },
    {
      "key": "e_1_3_1_27_2",
      "doi-asserted-by": "crossref",
      "first-page": "24",
      "DOI": "10.1016/0304-3940(92)90849-3",
      "volume": "139",
      "author": "Ali-Khan Z.",
      "year": "1992",
      "unstructured": "Ali-Khan Z., Normand J., Alizadeh-Khiavi K., Robitaille Y., Chronopoulos S., Neurosci. Lett. 139, 24 (1992).",
      "journal-title": "Neurosci. Lett."
    },
    {
      "key": "e_1_3_1_28_2",
      "doi-asserted-by": "crossref",
      "first-page": "96",
      "DOI": "10.1016/S0968-0004(96)10012-8",
      "volume": "21",
      "author": "Hilt W.",
      "year": "1996",
      "unstructured": "Hilt W., Wolf D. H., Trends Biochem. Sci. 21, 96 (1996).",
      "journal-title": "Trends Biochem. Sci."
    },
    {
      "key": "e_1_3_1_29_2",
      "doi-asserted-by": "crossref",
      "first-page": "153",
      "DOI": "10.1002/path.1711610210",
      "volume": "161",
      "author": "Lowe J.",
      "year": "1990",
      "unstructured": "Lowe J., McDermott H., Landon M., Mayer R. J., Wilkinson K. D., J. Pathol. 161, 153 (1990).",
      "journal-title": "J. Pathol."
    },
    {
      "key": "e_1_3_1_30_2",
      "doi-asserted-by": "crossref",
      "first-page": "21",
      "DOI": "10.1016/0304-3940(91)90751-E",
      "volume": "128",
      "author": "Kwak S.",
      "year": "1991",
      "unstructured": "Kwak S., Masaki T., Ishiura S., Sugita H., Neurosci. Lett. 128, 21 (1991).",
      "journal-title": "Neurosci. Lett."
    },
    {
      "key": "e_1_3_1_31_2",
      "unstructured": "F. W. van Leeuwen. J. P. H. Burbach D. Murphy unpublished results."
    },
    {
      "key": "e_1_3_1_32_2",
      "unstructured": "Single-letter abbreviations for the amino acid residues are as follows: A Ala; C Cys; D Asp; E Glu; F Phe; G Gly; H His; I Ile; K Lys; L Leu; M Met; N Asn; P Pro; Q Gln; R Arg; S Ser; T Thr; V Val; W Trp; and Y Tyr."
    },
    {
      "key": "e_1_3_1_33_2",
      "doi-asserted-by": "crossref",
      "first-page": "257",
      "DOI": "10.1016/0378-1119(90)90310-N",
      "volume": "87",
      "author": "Yoshikai S.",
      "year": "1990",
      "unstructured": "Yoshikai S., Sasaki H., Dohura K., Furuya M., Sakaki Y., Gene 87, 257 (1990).",
      "journal-title": "Gene"
    },
    {
      "key": "e_1_3_1_34_2",
      "doi-asserted-by": "crossref",
      "first-page": "443",
      "DOI": "10.1093/nar/15.2.443",
      "volume": "15",
      "author": "Baker R. T.",
      "year": "1987",
      "unstructured": "Baker R. T., Board P. G., Nucleic Acids Res. 15, 443 (1987).",
      "journal-title": "Nucleic Acids Res."
    },
    {
      "key": "e_1_3_1_35_2",
      "doi-asserted-by": "publisher",
      "DOI": "10.1038/355632a0"
    },
    {
      "key": "e_1_3_1_36_2",
      "unstructured": "We thank J. Verhaagen D. F. Swaab C. W. Pool J. J. van Heerikhuize T. P. van der Woude J. Wortel A. Holtrop J. Wouda M. Kooreman O. Pach and G. van der Meulen for their help and R. T. Baker I. Grundke-Iqbal P. Davies T. Hartmann and J. M. Octave for generously providing us with plasmid antisera and advice. Supported by Het Stimuleringsfonds Nederlandse Organisatie voor Wetenschappelijk Onderzoek-prioriteitsorogramma Geheugen processenen Dementie an Koninklijke Nederlandse Akademie van Wetenschappen grant the Matty Brand Foundation and the Jan Dekker and Ludgardine Bouwman Foundation."
    }
  ],
  "container-title": "Science",
  "original-title": [],
  "language": "en",
  "link": [
    {
      "URL": "https://www.science.org/doi/pdf/10.1126/science.279.5348.242",
      "content-type": "unspecified",
      "content-version": "vor",
      "intended-application": "similarity-checking"
    }
  ],
  "deposited": {
    "date-parts": [
      [
        2024,
        1,
        13
      ]
    ],
    "date-time": "2024-01-13T04:57:53Z",
    "timestamp": 1705121873000
  },
  "score": 1,
  "resource": {
    "primary": {
      "URL": "https://www.science.org/doi/10.1126/science.279.5348.242"
    }
  },
  "subtitle": [],
  "short-title": [],
  "issued": {
    "date-parts": [
      [
        1998,
        1,
        9
      ]
    ]
  },
  "references-count": 43,
  "journal-issue": {
    "issue": "5348",
    "published-print": {
      "date-parts": [
        [
          1998,
          1,
          9
        ]
      ]
    }
  },
  "alternative-id": [
    "10.1126/science.279.5348.242"
  ],
  "URL": "http://dx.doi.org/10.1126/science.279.5348.242",
  "relation": {},
  "ISSN": [
    "0036-8075",
    "1095-9203"
  ],
  "subject": [],
  "container-title-short": "Science",
  "published": {
    "date-parts": [
      [
        1998,
        1,
        9
      ]
    ]
  }
}