Binding of Neuroligins to PSD-95
10.1126/science.277.5331.1511
Crossref journal-article
American Association for the Advancement of Science (AAAS)
Science (221)
Abstract

PSD-95 is a component of postsynaptic densities in central synapses. It contains three PDZ domains that localize N -methyl- d -aspartate receptor subunit 2 (NMDA2 receptor) and K + channels to synapses. In mouse forebrain, PSD-95 bound to the cytoplasmic COOH-termini of neuroligins, which are neuronal cell adhesion molecules that interact with β-neurexins and form intercellular junctions. Neuroligins bind to the third PDZ domain of PSD-95, whereas NMDA2 receptors and K + channels interact with the first and second PDZ domains. Thus different PDZ domains of PSD-95 are specialized for distinct functions. PSD-95 may recruit ion channels and neurotransmitter receptors to intercellular junctions formed between neurons by neuroligins and β-neurexins.

Bibliography

Irie, M., Hata, Y., Takeuchi, M., Ichtchenko, K., Toyoda, A., Hirao, K., Takai, Y., Rosahl, T. W., & Südhof, T. C. (1997). Binding of Neuroligins to PSD-95. Science, 277(5331), 1511–1515.

Authors 9
  1. M. Irie (first)
  2. Y. Hata (additional)
  3. M. Takeuchi (additional)
  4. K. Ichtchenko (additional)
  5. A. Toyoda (additional)
  6. K. Hirao (additional)
  7. Y. Takai (additional)
  8. T. W. Rosahl (additional)
  9. T. C. Südhof (additional)
References 39 Referenced 619
  1. 10.1016/0896-6273(92)90245-9
  2. Kistner U., et al., J. Biol. Chem. 268, 4580 (1993); (10.1016/S0021-9258(18)53433-5) / J. Biol. Chem. by Kistner U. (1993)
  3. Hunt C. A., Schenker L. J., Kennedy M. B., J. Neurosci. 16, 1380 (1996); (10.1523/JNEUROSCI.16-04-01380.1996) / J. Neurosci. by Hunt C. A. (1996)
  4. Kim E., Cho K., Rothschild A., Sheng M., Neuron 17, 103 (1996); (10.1016/S0896-6273(00)80284-6) / Neuron by Kim E. (1996)
  5. ; B. M. Müller et al. ibid. p. 255.
  6. 10.1016/0092-8674(81)90009-X
  7. Ruff P., Speicher D. W., Husain-Chishti A., Proc. Natl. Acad. Sci. U.S.A. 88, 6595 (1991); (10.1073/pnas.88.15.6595) / Proc. Natl. Acad. Sci. U.S.A. by Ruff P. (1991)
  8. Willott E., et al., ibid. 90, 7834 (1993); / ibid. by Willott E. (1993)
  9. Woods D. F., Bryant P. J., J. Cell Sci. 17, 171 (1993); (10.1242/jcs.1993.Supplement_17.25) / J. Cell Sci. by Woods D. F. (1993)
  10. Jesaitis L. A., Goodenough D. A., J. Cell Biol. 124, 949 (1994). (10.1083/jcb.124.6.949) / J. Cell Biol. by Jesaitis L. A. (1994)
  11. 10.1126/science.7569905
  12. Kim E., Niethammer M., Rothschild A., Jan Y. N., Sheng M., Nature 378, 85 (1995); (10.1038/378085a0) / Nature by Kim E. (1995)
  13. Niethammer M., Kim E., Sheng M., J. Neurosci. 16, 2157 (1996); (10.1523/JNEUROSCI.16-07-02157.1996) / J. Neurosci. by Niethammer M. (1996)
  14. Lau L.-F., et al., J. Biol. Chem. 271, 21622 (1996). (10.1074/jbc.271.35.21622) / J. Biol. Chem. by Lau L.-F. (1996)
  15. 10.1016/0092-8674(95)90396-8
  16. Ichtchenko K., Nguyen T., Südhof T. C., J. Biol. Chem. 271, 2676 (1996). (10.1074/jbc.271.5.2676) / J. Biol. Chem. by Ichtchenko K. (1996)
  17. 10.1126/science.1621094
  18. Ushkaryov Y. A., Südhof T. C., Proc. Natl. Acad. Sci. U.S.A. 90, 6410 (1993) ; (10.1073/pnas.90.14.6410) / Proc. Natl. Acad. Sci. U.S.A. by Ushkaryov Y. A. (1993)
  19. Ushkaryov Y. A., et al., J. Biol. Chem. 259, 11987 (1994); (10.1016/S0021-9258(17)32671-6) / J. Biol. Chem. by Ushkaryov Y. A. (1994)
  20. Ullrich B., Ushkaryov Y. A., Südhof T. C., Neuron 14, 497 (1995). (10.1016/0896-6273(95)90306-2) / Neuron by Ullrich B. (1995)
  21. T. Nguyen and T. C. Südhof J. Biol. Chem. in press.
  22. Total RNA from forebrain was isolated from mice on postnatal days 0 2 5 7 10 12 15 20 30 and 60. RNA blots obtained with formaldehyde gels were hybridized with 32 P-labeled probes from neurexins neuroligins GAP-43 syntaxin 1 synaptobrevin 2 and synaptotagmin 1. All blots were hybridized with a GAPDH probe to control for RNA loading. 32 P signals were quantified by PhosphorImager detection and are expressed as ratio to GAPDH.
  23. A rat brain cDNA library in the yeast-two hybrid prey vector pVP16 [
  24. 10.1016/0092-8674(93)90307-C
  25. ] was screened as described [
  26. Fields S., Song O., Nature 340, 245 (1994); (10.1038/340245a0) / Nature by Fields S. (1994)
  27. ] (14) with the bait vector pBTM116-NL2-1 (8). Of 16 prey clones isolated pPrey500 encodes residues 1 to 287 and pPrey514 encodes residues 308 to 425 of PSD-95 (1). β-Galactosidase assays were corrected for protein concentration [M. D. Rose F. Winston P. Hieter Methods in Yeast Genetics (Cold Spring Harbor Laboratory Press Cold Spring Harbor NY 1990);
  28. Hata Y., Südhof T. C., J. Biol. Chem. 270, 13022 (1995)]. (10.1074/jbc.270.22.13022) / J. Biol. Chem. by Hata Y. (1995)
  29. The full-length sequence of rat PSD-95 (residues 1 to 724) its NH 2 -terminus (residues 1 to 431) and its COOH-terminus (residues 430 to 724) were cloned by PCR with oligonucleotides 1176 (GCGCTCGAGGTACCATGGACTGTCTCTGTATAGTGAC) 1177 (CGCGTCGACTAGAAGCCCCTCTTGGGGTT) 1178 (CGCCTCGAGGAATCAGAGTCTCTCTCGGGC) and 1198 (GCGAATTCTCCATGGGCTTCTACATTAGGGCC). To identify additional members of the PSD-95 family we used a degenerate PCR strategy. Products from PCRs with redundant oligonucleotide primers complementary to conserved sequences (T73 = TICCI- [C T]A[C T]ACIACI[C A]GICC; T75 = AC[G A] TCIA[G A]IAT[G A]CA[G A]TG; T76 = GGIGA[C T]ATI[C T]TICA[C T]GT; I = inosine; brackets = redundant positions) were subcloned and sequenced. We used two products (A290 and A309) containing unusual sequences related to PSD-95 as probes to isolate full-length clones pDLG54 and pDLG70 (GenBank accession numbers and ). The same two isoforms have been independently reported as PSD-93/chapsyn and SAP102 (1). pDLG54 is identical with SAP102 except for the absence of the sequence VTSNTSDSESSSKG (residues 627 to 630) (17) which suggests that pDLG54 represents a splice variant of SAP102. pDLG70 corresponds to PSD-93/chapsyn with several amino acid differences that may be due to alternative splicing or sequencing variations. The neuroligin bait vectors used encode the following residues of the rat proteins (4): pBTM116-NL1-1 718–843; pBTM116-NL1-2 718–840; pBTM116-NL1-5 718–828; pBTM116-NL1-6 828–843; pBTM116-NL1-10 796–843; pBTM116-NL2-1 699–836; pBTM116-NL2-2 699–786; pBTM116-NL2-3 786–836; pBTM116-NL3 730–848. The NMDA2 receptor bait plasmids encode residues 1455–1464 (pBTM116NMDAR2A) and 1473–1482 (pBTM116NMDAR2B) of the rat NMDA-2A and -2B receptors. pBTM116Shaker encodes residues 645–654 of the rabbit Kv1.4 K + channel isoform. The different prey vectors are from rat except for ZO-1 (mouse) and dlg-A ( Drosophila ) and encode the following residues: PSD-95 pVP16PSD-95-2 = 1–431; pVP16SAP90-5 = 69–150; pVP16SAP90-6 = 160–245. SAP102 pVP16SAP102-1 = 1–519. PSD-93 pVP16PSD-93-1 = 1–539. ZO1 pVP16ZO1-1 = 1–500. dlg-A pVP16dlg-1 = 1–598. Nitric oxide synthase pVP16NOS = 1–101.
  30. Doyle D. A., et al., Cell 85, 1067 (1996). (10.1016/S0092-8674(00)81307-0) / Cell by Doyle D. A. (1996)
  31. Synthetic peptides were purified on a Kromasil 100 C 18 reversed-phase column (sequences: NMDAR2A SNRRVYKKMPSIESDV; NL1-1 LPHPHPHPHSHSTTRV; NL1-2 LPHPHPHPHSHST; control KFIEAGQYNSHLYGTSV). NMDAR2A and NL1-1 correspond to the COOH-terminus of NMDA2A and neuroligin 1 respectively. NL1-2 is identical with NL1-1 except it lacks the last three amino acids. The control peptide is composed of residues 597 to 613 from PSD-95/SAP90. Peptides were immobilized on a CM5 research grade sensor chip with the amine coupling kit (Pharmacia) equilibrated with 50 mM Hepes-NaOH (pH 8.0) containing 100 mM NaCl and superfused with GST fusion proteins at different concentrations (flow rate 20 μl/min). Binding activities (in resonance units) were measured as the difference between the baseline value determined 10 s before sample injection and the measurements taken at the indicated time points. All experiments were performed at 25°C. Data were analyzed with the BIA Evaluation program 2.1 (Pharmacia) [
  32. Joehnsson U., et al., BioTechniques 11, 520 (1991)]. / BioTechniques by Joehnsson U. (1991)
  33. IgG fusion proteins of the extracellular domains of neurexin 1β with and without an insert in splice site 4 and control IgG fusion protein were purified from transfected COS cells (4). Twelve rat brains were homogenized in 48 ml of 20 mM Hepes-NaOH (pH 8.0) 1% (w/v) NP-40 0.2 M NaCl 2 mM EGTA and phenylmethylsulfonyl fluoride (0.1 g/liter) in a glass Teflon homogenizer and centrifuged (100 000 g for 60 min at 4°C). The supernatant (60 ml) was adjected to 3.5 mM CaCl 2 . Supernatant (20 ml) (0.2 to 0.3 g of protein) was incubated overnight at 4°C with recombinant IgG fusion proteins immobilized on protein A-Sepharose. Beads were washed repeatedly by centrifugation in 20 mM Hepes-NaOH (pH 8.0) 2.5 mM CaCl 2 0.2 M NaCl and 0.5% NP-40 and eluted sequentially with 0.3 ml of the wash buffer containing 0.5 M NaCl and with 0.5 ml of 20 mM Hepes-NaOH (pH 8.0) 0.1 M NaCl 10 mM EGTA and 0.5% NP-40. Fractions were analyzed by SDS–polyacrylamide gel electrophoresis and by immunoblotting with antibodies to PSD-95 (polyclonal antiserum L667 and two independent monoclonal antibodies) and to neuroligin 1 (polyclonal antiserum L067). To exclude the possibility that PSD-95 directly interacts with neurexin 1β extracts from COS cells transfected with full-length PSD-95 were affinity chromatographed on immobilized neurexin 1β in the absence and presence of recombinant neuroligin.
  34. HEK293 cells were transfected with pCMVPSD95-1 encoding full-length rat PSD-95 either alone or together with pCMVNL18 pCMVNR2A or pCMVNR1 encoding full-length neuroligin 1 NMDA2A or NMDA1 respectively. Cells were stained with a mouse monoclonal antibody to PSD-95 and rabbit polyclonal antibodies to neuroligin 1 (L067) or the two NMDA receptors (from Chemicon). Images were obtained on a Bio-Rad MRC1024 confocal microscope.
  35. 10.1523/JNEUROSCI.16-08-02488.1996
  36. Russell A. B., Carlson S. S., ibid. 17, 4734 (1997). / ibid. by Russell A. B. (1997)
  37. N. Uchida Y. Honjo K. R. Johnson M. J. Wheelock M. Takeichi J. Cell Biol. 135 767. (10.1083/jcb.135.3.767)
  38. Abbreviations for amino acids are as follows: A Ala; C Cys; D Asp; E Glu; F Phe; G Gly; H His; I Ile; K Lys; L Leu; M Met; N Asn; P Pro; Q Gln; R Arg; S Ser; T Thr; V Val; W Trp; Y Tyr.
  39. We thank A. Roth E. Borowicz and I. Leznicki for excellent technical assistance; M. B. Kennedy (CalTech) for monoclonal antibodies to PSD-95; S. Nakanishi (Kyoto) for NMDA receptor cDNA clones; and M. Missler M. S. Brown and J. L. Goldstein for advice. Partially supported by grants from the NIH (RO1-MH52804) the Perot Family Foundation and the ERATO (Japan Science and Technology Co.). Y.H. was supported by a postdoctoral fellowship from the HFSP and T.W.R. from the DFG.
Dates
Type When
Created 23 years ago (July 27, 2002, 5:50 a.m.)
Deposited 1 year, 7 months ago (Jan. 12, 2024, 10:52 p.m.)
Indexed 1 day, 6 hours ago (Aug. 24, 2025, 7:08 p.m.)
Issued 27 years, 11 months ago (Sept. 5, 1997)
Published 27 years, 11 months ago (Sept. 5, 1997)
Published Print 27 years, 11 months ago (Sept. 5, 1997)
Funders 0

None

@article{Irie_1997, title={Binding of Neuroligins to PSD-95}, volume={277}, ISSN={1095-9203}, url={http://dx.doi.org/10.1126/science.277.5331.1511}, DOI={10.1126/science.277.5331.1511}, number={5331}, journal={Science}, publisher={American Association for the Advancement of Science (AAAS)}, author={Irie, M. and Hata, Y. and Takeuchi, M. and Ichtchenko, K. and Toyoda, A. and Hirao, K. and Takai, Y. and Rosahl, T. W. and Südhof, T. C.}, year={1997}, month=sep, pages={1511–1515} }