AIB1, a Steroid Receptor Coactivator Amplified in Breast and Ovarian Cancer
10.1126/science.277.5328.965
Crossref journal-article
American Association for the Advancement of Science (AAAS)
Science (221)
Abstract

Members of the recently recognized SRC-1 family of transcriptional coactivators interact with steroid hormone receptors to enhance ligand-dependent transcription. AIB1, a member of the SRC-1 family, was cloned during a search on the long arm of chromosome 20 for genes whose expression and copy number were elevated in human breast cancers. AIB1 amplification and overexpression were observed in four of five estrogen receptor–positive breast and ovarian cancer cell lines. Subsequent evaluation of 105 unselected specimens of primary breast cancer found AIB1 amplification in approximately 10 percent and high expression in 64 percent of the primary tumors analyzed. AIB1 protein interacted with estrogen receptors in a ligand-dependent fashion, and transfection of AIB1 resulted in enhancement of estrogen-dependent transcription. These observations identify AIB1 as a nuclear receptor coactivator whose altered expression may contribute to development of steroid-dependent cancers.

Bibliography

Anzick, S. L., Kononen, J., Walker, R. L., Azorsa, D. O., Tanner, M. M., Guan, X.-Y., Sauter, G., Kallioniemi, O.-P., Trent, J. M., & Meltzer, P. S. (1997). AIB1, a Steroid Receptor Coactivator Amplified in Breast and Ovarian Cancer. Science, 277(5328), 965–968.

Authors 10
  1. Sarah L. Anzick (first)
  2. Juha Kononen (additional)
  3. Robert L. Walker (additional)
  4. David O. Azorsa (additional)
  5. Minna M. Tanner (additional)
  6. Xin-Yuan Guan (additional)
  7. Guido Sauter (additional)
  8. Olli-P. Kallioniemi (additional)
  9. Jeffrey M. Trent (additional)
  10. Paul S. Meltzer (additional)
References 31 Referenced 1,252
  1. Devilee P., Schuuring E., van de Vijver M. J., Cornelisse C. J., Crit. Rev. Oncog. 5, 247 (1994). (10.1615/CritRevOncog.v5.i2-3.70) / Crit. Rev. Oncog. by Devilee P. (1994)
  2. Isola J. J., et al., Am. J. Pathol. 147, 905 (1995); / Am. J. Pathol. by Isola J. J. (1995)
  3. Kallioniemi A., et al., Proc. Natl. Acad. Sci. U.S.A. 91, 2156 (1994); (10.1073/pnas.91.6.2156) / Proc. Natl. Acad. Sci. U.S.A. by Kallioniemi A. (1994)
  4. Muleris M., Almeida A., Gerbault-Seureau M., Malfoy B., Dutrillaux B., Genes Chromosomes Cancer 10, 160 (1994); (10.1002/gcc.2870100303) / Genes Chromosomes Cancer by Muleris M. (1994)
  5. Tanner M. M., et al., Cancer Res. 54, 4257 (1994); / Cancer Res. by Tanner M. M. (1994)
  6. Guan X.-Y., Meltzer P. S., Dalton W. S., Trent J. M., Nature Genet. 8, 155 (1994). (10.1038/ng1094-155) / Nature Genet. by Guan X.-Y. (1994)
  7. Guan X.-Y., et al., Cancer Res. 56, 3446 (1996). / Cancer Res. by Guan X.-Y. (1996)
  8. S. A. Onate S. Y. Tsai M.-J. Tsai B. W. O'Malley Science 270 1354 (1995). (10.1126/science.270.5240.1354)
  9. Voegel J. J., Heine M. J. S., Zechel C., Chambon P., Gronemeyer H., EMBO J. 15, 3667 (1996). (10.1002/j.1460-2075.1996.tb00736.x) / EMBO J. by Voegel J. J. (1996)
  10. Hanstein B., et al., Proc. Natl. Acad. Sci. U.S.A. 93, 11540 (1996); (10.1073/pnas.93.21.11540) / Proc. Natl. Acad. Sci. U.S.A. by Hanstein B. (1996)
  11. Kamei Y., et al., Cell 85, 403 (1996); (10.1016/S0092-8674(00)81118-6) / Cell by Kamei Y. (1996)
  12. Yao T.-P., Ku G., Zhou N., Scully R., Livingston D. M., Proc. Natl. Acad. Sci. U.S.A. 93, 10626 (1996). (10.1073/pnas.93.20.10626) / Proc. Natl. Acad. Sci. U.S.A. by Yao T.-P. (1996)
  13. An AIB1-specific primer N8F1 (TCATCACTTCCGACAACAGAGG) was biotinylated and used to capture cDNA clones from a human lung cDNA library (Gibco BRL) with the GENETRAPPER cDNA positive selection system (Gibco BRL). The largest clone (5.8 kb) designated pCMVSPORT-B11 was selected for sequence analysis. To obtain full-length AIB1 sequence we constructed a random-primed library from BT474 in bacteriophage λ-Zap (Stratagene) and hybridized it with a 372-base pair 32 P-labeled polymerase chain reaction (PCR) product amplified from a human spleen cDNA library by using primers designed from the 5′ sequence of pCMVSPORT-B11 PM-U2 (CCAGAAACGTCACTATCAAG) and Bll-llRA (TTACTGGAACCCCCATACC). Plasmid rescue of 19 positive clones yielded a clone pBluescript-R22 that overlapped pCMVSPORT-B11 and contained the 5′ end of the coding region. To generate a full-length AIB1 clone we subcloned the 4.85-kb Hind III–Xho I fragment of pCMVSPORT-B11 into the Hind III–Xho I sites of pBluescript-R22. We then subcloned the 4.84-kb Not I–Nhe I fragment of the full-length clone containing the entire coding region into the Not I–Xba I sites of the expression vector pcDNA3.1 (Invitrogen) and generated pcDNA3.1-AIB1.
  14. 10.1016/S0022-2836(05)80360-2
  15. 10.1038/42750
  16. 10.1038/42652
  17. We obtained established breast cancer cell lines from the American Type Culture Collection (ATCC) (BT474 MCF-7 T-47D MDA-MB-361 MDA-MB-468 BT-20 MDA-MB-436 and MDA-MB-453) the Arizona Cancer Center (UACC-812) and the National Cancer Institute (ZR75-1). We obtained ovarian cancer cell line BG-1 from Jeff Boyd University of Pennsylvania. For Northern analysis we obtained normal human mammary gland total RNA pooled from six individuals between 16 and 35 years old from Clontech. For FISH analysis interphase nuclei were fixed in methanol and acetic acid (3:1) and dropped onto microscope slides.
  18. Data not shown.
  19. The BioPrime DNA labeling system (Gibco BRL) was used to label genomic clones containing either AIB1 (3) or the 20q13 amplicon (RMC20C001) (14) with Spectrum Orange deoxyuridine triphosphate (dUTP) (Vysis). We used 20q11 and 20p probes (University of California Berkeley Resource for Molecular Cytogenetics RMC20P037 and RMC20P039) as reference probes for two-color FISH analysis after labeling with biotin-16-dUTP (BMB) by nick-translation. FISH followed the method of Pinkel et al. (19) with minor modifications. Fluorescent images were captured with a Zeiss axiophot microscope equipped with a charge-coupled device camera and IP Lab Spectrum software (Signal Analytics). FISH analysis of uncultured breast cancer samples was performed as described (14) from either disaggregated nuclei or sections of ethanol-fixed tumors. Tumors were categorized into three groups according to AIB1 copy number: low (fewer than four copies per cell or no increased relative copy number) moderate (four to six copies per cell or 1.5- to 3-fold relative copy number) and high (more than six copies per cell or >3-fold relative copy number). Only high copy number increases were taken as evidence for gene amplification. In 105 unselected cases 10 were scored high 13 were moderate and 82 were low. ER status was determined by immunohistochemistry for 83 of these specimens including 9 of the 10 cases with AIB1 amplification. Of these nine specimens four were ER positive and five were ER negative.
  20. Tanner M. M., et al., Cancer Res. 56, 3441 (1996). / Cancer Res. by Tanner M. M. (1996)
  21. AIB1 mRNA in situ expression was determined by using three cDNA fragments (covering nucleotides 1733 to 2579 3072 to 3580 and 3533 to 4120 of the AIB1 cDNA) labeled with deoxyadenosine [ 33 P]triphosphate by PCR. We hybridized ethanol-fixed sections from 75 primary breast tumors and six adjacent normal breast tissues as described (20). We knew the ER status for 66 of these samples. AIB1 was highly expressed in 24 of 44 (55%) of the ER-positive cases and in 8 of 22 (36%) of the ER-negative cases.
  22. CV-1 cells (ATCC) were grown and maintained in phenol red–free Dulbecco's modified Eagle's medium supplemented with 10% charcoal-stripped fetal bovine serum. We plated cells into six-well culture dishes at 1.0 × 10 5 cells per well and allowed them to grow overnight. Transfections were done with calcium phosphate coprecipitation (Clontech) according to the manufacturer's protocol. Transfected DNA included 5 ng of pRL-CMV internal control plasmid 1.0 μg of ER reporter 250 ng of pHEGO-hyg ER expression vector the indicated amount of pcDNA3.1-AIB1 or an equivalent amount of pcDNA3.1 empty vector and salmon sperm DNA to a total of 7 μg of DNA per dish. After transfection we incubated cells in the absence or presence of 10 nM 17β-estradiol or 100 nM 4-OHT. Cell lysates were harvested and assayed 48 hours after transfection. We determined reporter activities with the dual-luciferase reporter assay system (Promega) and the results are expressed in relative luminescence units (RLU) (luciferase/ Renilla luciferase). We obtained pRL-CMV and pGL3-promoter from Promega and pHEGO-hyg from ATCC. ER reporter pGL3.luc.3ERE which contains three tandem copies of the ERE upstream from the simian virus 40 promoter driving the luciferase gene was the kind gift of Fern Murdoch Uniformed Services University of the Health Sciences.
  23. We constructed GST fusion proteins by generating PCR fragments of AIB1 encoding amino acids 1 to 194 and amino acids 605 to 1294 inserted into pGEX 6P-2 (Pharmacia). GST pulldown analysis was done as described by Le Douarin (21) with the following modifications: 6.7 μg of ER (Panvera) was preincubated with or without 2 μM estradiol. Separately we preincubated 10 μg of either GST GST-AIB.N1 (containing amino acids 1 to 194) or GST-AIB.T1 (containing amino acids 605 to 1294) with preequilibrated glutathione-Sepharose (Pharmacia) and washed it with binding buffer. ER with or without estradiol mixture was incubated with GST fusion protein-glutathione-Sepharose mixture in binding buffer containing 0.1% bovine serum albumin for 1 hour at room temperature. Glutathione-Sepharose beads were washed five times in binding buffer and bound proteins were eluted in SDS–polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer and separated by SDS-PAGE. Separated proteins were transferred to nylon membranes incubated sequentially with monoclonal antibody H-151 to ER (StressGen) and horseradish peroxidase containing goat anti-mouse immunoglobulin G Fc (Jackson Immunoresearch) and detected by chemiluminescence.
  24. Hong H., Kohli K., Garabedian M. J., Stallcup M. R., Mol. Cell. Biol. 17, 2735 (1997). (10.1128/MCB.17.5.2735) / Mol. Cell. Biol. by Hong H. (1997)
  25. Pinkel D., Straume T., Gray J., Proc. Natl. Acad. Sci. U.S.A. 83, 2934 (1986). (10.1073/pnas.83.9.2934) / Proc. Natl. Acad. Sci. U.S.A. by Pinkel D. (1986)
  26. Sallinen P., et al., Am. J. Pathol. 150, 1159 (1997). / Am. J. Pathol. by Sallinen P. (1997)
  27. LeDouarin B., et al., EMBO J. 14, 2020 (1995). (10.1002/j.1460-2075.1995.tb07194.x) / EMBO J. by LeDouarin B. (1995)
  28. Abbreviations for the amino acids are as follows: A Ala; C Cys; D Asp; E Glu; F Phe; G Gly; H His; I Ile; K Lys; L Leu; M Met; N Asn; P Pro; Q Gln; R Arg; S Ser; T Thr; V Val; W Trp; and Y Tyr.
  29. We obtained cDNA clones from Research Genetics [TIF2 (clone 132364 GenBank accession number ) SRC-1 (clone 418064 GenBank accession number )] ATCC (pHEGO-hyg ATCC number 79995) or Clontech (β-actin). The AIB1 probe was a 2.2-kb Not I–Sac I fragment of pCMVSPORT-B11.
  30. J. Sambrook E. F. Fritsch T. Maniatis Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press Cold Spring Harbor NY 1989).
  31. The authors gratefully acknowledge the technical assistance of Nasser Parsa and Robin Veldman Darryl Leja for preparation of the illustrations and Roger Meisfeld for helpful discussions.
Dates
Type When
Created 23 years ago (July 27, 2002, 5:39 a.m.)
Deposited 1 year, 7 months ago (Jan. 13, 2024, 12:48 a.m.)
Indexed 21 hours, 16 minutes ago (Aug. 26, 2025, 2:48 a.m.)
Issued 28 years ago (Aug. 15, 1997)
Published 28 years ago (Aug. 15, 1997)
Published Print 28 years ago (Aug. 15, 1997)
Funders 0

None

@article{Anzick_1997, title={AIB1, a Steroid Receptor Coactivator Amplified in Breast and Ovarian Cancer}, volume={277}, ISSN={1095-9203}, url={http://dx.doi.org/10.1126/science.277.5328.965}, DOI={10.1126/science.277.5328.965}, number={5328}, journal={Science}, publisher={American Association for the Advancement of Science (AAAS)}, author={Anzick, Sarah L. and Kononen, Juha and Walker, Robert L. and Azorsa, David O. and Tanner, Minna M. and Guan, Xin-Yuan and Sauter, Guido and Kallioniemi, Olli-P. and Trent, Jeffrey M. and Meltzer, Paul S.}, year={1997}, month=aug, pages={965–968} }