Telomerase Catalytic Subunit Homologs from Fission Yeast and Human
10.1126/science.277.5328.955
Crossref journal-article
American Association for the Advancement of Science (AAAS)
Science (221)
Abstract

Catalytic protein subunits of telomerase from the ciliate Euplotes aediculatus and the yeast Saccharomyces cerevisiae contain reverse transcriptase motifs. Here the homologous genes from the fission yeast Schizosaccharomyces pombe and human are identified. Disruption of the S. pombe gene resulted in telomere shortening and senescence, and expression of mRNA from the human gene correlated with telomerase activity in cell lines. Sequence comparisons placed the telomerase proteins in the reverse transcriptase family but revealed hallmarks that distinguish them from retroviral and retrotransposon relatives. Thus, the proposed telomerase catalytic subunits are phylogenetically conserved and represent a deep branch in the evolution of reverse transcriptases.

Bibliography

Nakamura, T. M., Morin, G. B., Chapman, K. B., Weinrich, S. L., Andrews, W. H., Lingner, J., Harley, C. B., & Cech, T. R. (1997). Telomerase Catalytic Subunit Homologs from Fission Yeast and Human. Science, 277(5328), 955–959.

Authors 8
  1. Toru M. Nakamura (first)
  2. Gregg B. Morin (additional)
  3. Karen B. Chapman (additional)
  4. Scott L. Weinrich (additional)
  5. William H. Andrews (additional)
  6. Joachim Lingner (additional)
  7. Calvin B. Harley (additional)
  8. Thomas R. Cech (additional)
References 55 Referenced 1,775
  1. Greider C. W., Blackburn E. H., Nature 337, 331 (1989). (10.1038/337331a0) / Nature by Greider C. W. (1989)
  2. C. W. Greider K. Collins C. Autexier in DNA Replication in Eukaryotic Cells M. L. DePamphilis Ed. (Cold Spring Harbor Laboratory Press Cold Spring Harbor NY 1996) pp. 619–638.
  3. 10.1073/pnas.78.5.3015
  4. McEachern M. J., Blackburn E. H., Nature 376, 403 (1995); (10.1038/376403a0) / Nature by McEachern M. J. (1995)
  5. Cooper J. P., Nimmo E. R., Allshire R. C., Cech T. R., ibid. 385, 744 (1997); / ibid. by Cooper J. P. (1997)
  6. 10.1126/science.275.5302.986
  7. Zakian V. A., ibid. 270, 1601 (1995). / ibid. by Zakian V. A. (1995)
  8. Harley C. B., Futcher A. B., Greider C. W., Nature 345, 458 (1990); (10.1038/345458a0) / Nature by Harley C. B. (1990)
  9. Hastie N. D., et al., ibid. 346, 866 (1990); / ibid. by Hastie N. D. (1990)
  10. Harley C. B., et al., Cold Spring Harbor Symp. Quant. Biol. 59, 307 (1994). (10.1101/SQB.1994.059.01.035) / Cold Spring Harbor Symp. Quant. Biol. by Harley C. B. (1994)
  11. Counter C. M., et al., EMBO J. 11, 1921 (1992); (10.1002/j.1460-2075.1992.tb05245.x) / EMBO J. by Counter C. M. (1992)
  12. Shay J. W., Bacchetti S., Eur. J. Cancer 33, 787 (1997). (10.1016/S0959-8049(97)00062-2) / Eur. J. Cancer by Shay J. W. (1997)
  13. 10.1126/science.7605428
  14. Feng J., et al., ibid. 269, 1236 (1995). / ibid. by Feng J. (1995)
  15. Collins K., Kobayashi R., Greider C. W., Cell 81, 677 (1995). (10.1016/0092-8674(95)90529-4) / Cell by Collins K. (1995)
  16. 10.1126/science.275.5302.973
  17. Nakayama J., Saito M., Nakamura H., Matsuura A., Ishikawa F., Cell 88, 875 (1997). (10.1016/S0092-8674(00)81933-9) / Cell by Nakayama J. (1997)
  18. Lingner J., Cech T. R., Proc. Natl. Acad. Sci. U.S.A. 93, 10712 (1996). (10.1073/pnas.93.20.10712) / Proc. Natl. Acad. Sci. U.S.A. by Lingner J. (1996)
  19. 10.1126/science.276.5312.561
  20. Lendvay T. S., Morris D. K., Sah J., Balasubramanian B., Lundblad V., Genetics 144, 1399 (1996). (10.1093/genetics/144.4.1399) / Genetics by Lendvay T. S. (1996)
  21. C. M. Counter M. Meyerson E. N. Eaton R. A. Weinberg Proc. Natl. Acad. Sci. U.S.A. in press.
  22. PCR primers were based on motif B′ (YARACHAARGGHATYCCHYARGG) and motif C (NGTNATDARDARRTARTCRTC) where D = G A or T; H = T A or C; Y = T or C; R = A or G; and N = G A T or C. Approximately 10 6 colonies of an S. pombe Hind III–cut genomic library in pWH5 [
  23. Wright A., Maundrell K., Heyer W. D., Beach D., Nurse P., Plasmid 15, 156 (1986); (10.1016/0147-619X(86)90051-X) / Plasmid by Wright A. (1986)
  24. ] and 10 5 colonies of an S. pombe cDNA library [
  25. Javerzat J.-P., Cranston G., Allshire R. C., Nucleic Acids Res. 24, 4676 (1996); (10.1093/nar/24.23.4676) / Nucleic Acids Res. by Javerzat J.-P. (1996)
  26. ] were screened.
  27. These cDNA clones terminated in the exon flanked by introns 4 and 5. Poly A + RNA from S. pombe was reverse transcribed using primer M2-B14 (CCTTGGAAAAATCCATTGAAGCCACATGTG). The resulting cDNA was ligated to oligonucleotide pGGGCCGTGTTGGCCTAGTTCTCTGCTCddA using T4 RNA ligase and amplified by two rounds of PCR: in the first round we used primers M2-B14 and Adapt-Sfi (GAGGAGGAGAAGAGCAGAGAACTAGGCCAACACGGCCC) and in the second we used primers M2-B15 (AAAGTGGTATGCCAGAAATCTGAAGGTAAT) and Adapt-Sfi.
  28. Zhang M. Q., Marr T. G., Nucleic Acids Res. 22, 1750 (1994); (10.1093/nar/22.9.1750) / Nucleic Acids Res. by Zhang M. Q. (1994)
  29. . Sequencing of the three original cDNA clones and nine cloned RT-PCR products revealed that two 3′ splice sites were used at similar frequency for splicing of intron 8. These sites were separated by 3 nts giving rise to predicted proteins of 988 and 989 amino acids.
  30. 10.1016/0092-8674(93)90234-H
  31. 10.1101/gad.10.14.1822
  32. Clone 712562 was obtained from the I.M.A.G.E. (Integrated Molecular Analysis of Genomes and Their Expression) Consortium [
  33. 10.1006/geno.1996.0177
  34. ]. This clone did not encode a contiguous portion of a TRT because motifs B′ C D and E were contained in a different ORF than the more NH 2 -terminal motifs. In addition the distance between motifs A and B′ was substantially shorter than that of the other three TRTs.
  35. A lambda cDNA library from the human 293 cell line which has high levels of telomerase activity was partitioned into 25 pools containing ∼200 000 plaques each. These were screened by PCR with primers LT5 (CGGAAGAGTGTCTGGAGCAA) and LT6 (GGATGAAGCGGAGTCTGGA) to the 5′ region of the #712562 clone insert. Six subpools of one positive primary pool were further screened by PCR. One positive subpool was then screened by plaque hybridization with a probe from the 5′ region of clone #712562. One phage was positively identified and the ∼4 kbp insert from this clone was excised and subcloned into the pBluescript II SK+ vector (Stratagene) as an Eco RI fragment.
  36. Polyadenylated RNAs from human testis and from the 293 cell line were amplified using a nested PCR strategy. The first primer set was TCP1.1 (GTGAAGGCACTGTTCAGCG) and TCP1.15 (CGCGTGGGTGAGGTGAGGTG); the second primer set was TCP1.14 (CTGTGCTGGGCCTGGACGATA) and bTCP6 (AGCTTGTTCTCCATGTCGCCGTAG).
  37. hTRT mRNA was amplified using oligonucleotide primers LT5 and LT6 (19) for 31 cycles (94°C for 45 s 60°C for 45 s 72°C for 90 s). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA was amplified using primers K136 (CTCAGACACCATGGGGAAGGTGA) and K137 (ATGATCTTGAGGCTGTTGTCATA) for 16 cycles (94°C for 45 s 55°C for 45 s 72°C for 90 s). hTR was amplified using primers F3b (TCTAACCCTAACTGAGAAGGGCGTAG) and R3c (GTTTGCTCTAGAATGAACGGTGGAAG) for 22 cycles (94°C for 45 s 55°C for 45 s 72°C for 90 s). TP1 mRNA was amplified using primers TP1.1 (TCAAGCCAAACCTGAATCTGAG) and TP1.2 (CCCGAGTGAATCTTTCTACGC) for 28 cycles (cycles same as for hTRT). Reaction products were resolved on an 8% polyacrylamide gel stained with SYBR Green I (Molecular Probes Eugene OR).
  38. 10.1126/science.1377403
  39. 10.1073/pnas.90.13.6320
  40. Patel P. H., et al., Biochemistry 34, 5351 (1995). (10.1021/bi00016a006) / Biochemistry by Patel P. H. (1995)
  41. Xiong Y., Eickbush T. H., EMBO J. 9, 3353 (1990); (10.1002/j.1460-2075.1990.tb07536.x) / EMBO J. by Xiong Y. (1990)
  42. ; T. H. Eickbush in The Evolutionary Biology of Viruses S. S. Morse Ed. (Raven New York 1994) pp. 121–157.
  43. Powell M. D., et al., J. Biol. Chem. 272, 13262 (1997). (10.1074/jbc.272.20.13262) / J. Biol. Chem. by Powell M. D. (1997)
  44. Ricchetti M., Buc H., Biochemistry 35, 14970 (1996). (10.1021/bi961274v) / Biochemistry by Ricchetti M. (1996)
  45. Biessmann H., et al., Cell 61, 663 (1990); (10.1016/0092-8674(90)90478-W) / Cell by Biessmann H. (1990)
  46. Levis R. W., Ganesan R., Houtchens K., Tolar L. A., Sheen F., ibid. 75, 1 (1993); / ibid. by Levis R. W. (1993)
  47. Pardue M. L., Danilevskaya O. N., Lowenhaupt K., Slot F., Traverse K. L., Trends Genet. 12, 48 (1996). (10.1016/0168-9525(96)81399-0) / Trends Genet. by Pardue M. L. (1996)
  48. h + /h − leu1-32/leu1-32 ura4-D18/ura4-D18 ade6-M210/ade6-M216 his3-D1/his3-D1 trt1 + /trt1 − :: his3 + .
  49. C. Alfa P. Fantes J. Hyams M. McLoed E. Warbrick Experiments with Fission Yeast (Cold Spring Harbor Laboratory Press Cold Spring Harbor NY 1993).
  50. Saitou N., Nei M., Mol. Biol. Evol. 4, 406 (1987); / Mol. Biol. Evol. by Saitou N. (1987)
  51. . GenBank protein identification numbers of the sequences used in the phylogenetic analysis can be obtained from the authors. Alignment was analyzed using ClustalW 1.5 [
  52. 10.1093/nar/22.22.4673
  53. ] and PHYLIP 3.5 [
  54. Felsenstein J., Cladistics 5, 164 (1989)]. / Cladistics by Felsenstein J. (1989)
  55. We thank R. Adams B. Lastelic L. Tonkin and F. Wu for expert technical assistance; C. Chapon J. P. Cooper R. Gutell E. Jabri and J. Sperger for discussions; R. Allshire and J. A. Wise for plasmids and yeast strains; C. Mattison and the L. Pillus lab for help with microscopy; and A. Sirimarco for manuscript preparation. An S. pombe cDNA library was provided by C. J. Norbury and B. Edgar. Supported by NIH grant GM28039 (T.R.C).
Dates
Type When
Created 23 years, 1 month ago (July 27, 2002, 5:35 a.m.)
Deposited 1 year, 7 months ago (Jan. 13, 2024, 12:46 a.m.)
Indexed 3 weeks, 3 days ago (Aug. 6, 2025, 8:56 a.m.)
Issued 28 years ago (Aug. 15, 1997)
Published 28 years ago (Aug. 15, 1997)
Published Print 28 years ago (Aug. 15, 1997)
Funders 0

None

@article{Nakamura_1997, title={Telomerase Catalytic Subunit Homologs from Fission Yeast and Human}, volume={277}, ISSN={1095-9203}, url={http://dx.doi.org/10.1126/science.277.5328.955}, DOI={10.1126/science.277.5328.955}, number={5328}, journal={Science}, publisher={American Association for the Advancement of Science (AAAS)}, author={Nakamura, Toru M. and Morin, Gregg B. and Chapman, Karen B. and Weinrich, Scott L. and Andrews, William H. and Lingner, Joachim and Harley, Calvin B. and Cech, Thomas R.}, year={1997}, month=aug, pages={955–959} }